Effects of Biochemical and Molecular Inhibitors of Plant Extracts on Pathogenic Bacteria ()
1. Introduction
The use of antibiotics has been an effective treatment option for a variety of microbial infections. Antibiotic misuse or overuse has contributed to the creation of a new generation of antibiotic-resistant microorganisms. One important area of study is testing the level of susceptibility and drug-resistance in microorganisms to specific antibiotics. The European Centre for Disease Prevention and Control (ECDC) and the Centers for Disease Control and Prevention (CDC) created terminology to define the various levels of the acquired antibiotic resistance profiles in microorganisms: multidrug resistant (MDR) was defined as “acquired non-susceptibility to at least one agent in three or more antibiotics”, extremely drug resistant (XDR) was defined as “non-susceptibility to at least one agent in all but two or fewer antimicrobial categories”, and pan drug resistant (PDR) was defined as “non-susceptibility to all agents in all antibiotics”. The study covered Staphylococcus aureus, Enterococcus spp., Enterobacteriaceae, Pseudomonas aeruginosa and Acinetobacter spp. [1] . Many bacteria strains were identified as MDR, XDR or PDR, including P. aeruginosa, Klebsiella pneumoniae, S. aureus and Enterococcus spp., E. coli, and Acinetobacter spp. [2] [3] [4] .
The development of new antimicrobial agents required to address the new generation of drug-resistant microorganisms currently on the rise is vital. Microbiota found in malt and marine environments, shows great promise in being potential sources of antimicrobial active compounds.
Several medical research studies have shown some marine algae contain organic compounds that have a broad range of biological activities, including antibacterial, antifungal, antioxidant, antifouling, anti-inflammatory, cytotoxic, anticancer and antimitotic properties [5] [6] [7] [8] . The macroalgae Ulva lactuca has been shown to exhibit antimicrobial activity against gram positive and gram negative bacteria such as S. aureus, S. epidermidis, S. saprophyticus, Strepto- coccus agalactiae (group B), S. pyogenes, Enterococcus faecalis, Bacillus subtilis, Lactobacillus acidophilus, P. aeruginosa, E. coli, Enterobacter aerogenes, Stenotrophomonas maltophilia, Salmonella typhimurium, Shigella sonnei, Proteus vulgaris and P. mirabilis [9] [10] [11] .
Many soil-grown plants, called medicinal plants, have been shown to express bioactive compounds that can act as antimicrobial agents. These secondary metabolites produced by medicinal are an important source for pharmaceutical drugs. In fact, bioactive products derived from medicinal plants are a principal source of pharmaceutical agents used in traditional medicine and work by acting as antimicrobial agents against pathogenic microorganisms [12] [13] [14] .
Several plants have been defined as medicinal and have been used for years to treat infectious diseases, such as Thymol sp., Ocimum sp., Oregano sp. and Nigella sp. [15] [16] [17] . Seed extracts and essential oils of Nigella sativa have been used to treat a variety of diseases and are shown to have various pharmacological properties including antimicrobial actions [18] [19] . N. sativa has an inhibitory effect on MRSA, S. aureus, S. epidermidis, E. coli, S. typhi, S. enteritidis, Klebsiella sp. and Enterobacter aerogenes [20] [21] .
The present investigation aims to study the influence of methanol extract of green alga Ulva lactuca and medicinal plant Nigella sativa on the activity and molecular genetics of pathogenic Gram positive cocci Staphylococcus aureus and the Gram negative bacilli Pseudomonas aeruginosa.
2. Materials and Methods
2.1. Extract Preparation
The green alga Ulva lactuca and the seeds of medicinal plant Nigella sativa were collected from Jeddah, Saudi Arabia. The samples were cleaned, washed with distilled water, dried at 40˚C and powdered in a mixer grinder. The powdered samples were extracted by soaking in methanol (1:10, w/v) for several times at room temperature. The deposits were then used as crude extracts. The extracts were dried under vacuum pressure at 40˚C [22] [23] . The crude extract was stored at −20˚C until required.
2.2. Test Bacteria
The tested bacteria Staphylococcus aureus and Pseudomonas aeruginosa were isolated and identified at King Abdulaziz University Hospital, Jeddah, Saudi Arabia. The isolates were grown on Mueller-Hinton agar (OXOID CM 337) [24] [25] [26] .
2.3. Biochemical Analyses
The pathogenic bacteria (1 × 105 CFU·ml−1) were incubated with 100 μl crude extracts (100 mg·ml−1) at different intervals (20, 40, 60 and 80 mins) in Mueller-Hinton broth at 37˚C [27] . The extracellular potassium and phosphorus concentrations were estimated by a photometric procedure using EasyRA Medica and COBAS® INTEGRA 400 plus, respectively. The results were expressed as the value of extracellular free potassium and phosphorus ions in the medium (mmol·L−1).
The effect of different concentrations (50 and 100 µl) of crude extract (100 mg·ml−1) on glucose uptake and dry weight of bacteria was investigated according to [28] . The pathogenic bacteria (1 × 105 CFU·ml−1) were inoculated into Mueller-Hinton broth and incubated with the different concentrations of extract on a shaker (180 rpm) at 37˚C for 24 h. Samples were then centrifuged at 10,000 rpm for 10 mins. Glucose uptake was measured in the suspension solution by using COBAS® INTEGRA 400 plus. The pellets were washed triple with distilled water and centrifuged at 10,000 rpm for 10 mins and then dried at 80°C. Bacterial growth was measured as dry weight. Each treatment was performed in triplicate.
2.4. Molecular Analyses
The effect of U. lactuca and N. sativa extract on the genetic material of pathogenic bacteria was studied as recommended by [29] . The bacterial DNA was extracted with methanol using Qiagen DNA extraction kit (Molecular sequencing of the mecA gene in S. aureus and acsA gene in P. aeruginosa) and the following PCR primers:
S. aureus
MR1 TAGAAATGACTGAACGTCCG;
MR2 TTGCGATCAAATGTTACCGTAG;
MR3 AAAATCGATGGTAAAGGTTGGC;
MR4 AGTTCTGCAGTACCGGATTTTGC.
P. aeruginosa
acsA-F GCCACACCTACATCGTCTAT;
acsA-R AGGTTGCCGAGGTTGTCCAC.
The DNA was sequenced by Macrogene (https://www.macrogenusa.com/) and analyzed by BLAST software (http://blast.ncbi.nlm.nih.gov/Blast.cgi).
2.5. Scanning Electron Microscopy (SEM) Analyses
A thin film of treated bacterial cells with 50 μl of U. lactuca and N. sativa extracts (100 mg∙ml−1) were smeared on a silver stub for analysis by SEM [30] [31] . The samples were coated with gold by cathodic spraying (Polaron gold) and then dried under a mercury lamp for 5 mins. The morphology of S. aureus and P. aeruginosa were observed by using scanning electron microscope at Nano Center of KAU (JEOL, JSM-7600F 450).
2.6. Statistical Analysis
The results were analyzed by paired-samples t-test using the IBM SPSS 20 statistical software to compare the mean values of each treatment. The results are expressed as the means ± SD. Probability levels of less than 0.01 were considered highly significant.
3. Results
3.1. Biochemical Analyses
The treatment of S. aureus and P. aeruginosa with 100 µl U. lactuca and N. sativa crude extract (100 mg·ml−1) showed an increase in the leakage of potassium and phosphorus ions with increasing time of incubation (20, 40, 60 and 80 minutes). The levels of potassium 68.54% and phosphorus 38.24% recorded highly significant increase (P < 0.01) in the bacterial medium of S. aureus treated with N. sativa extract (Figure 1). At the same time, the treatment of P. aeruginosa with U. lactuca extract (Figure 2) induced the presence of maximum level of potassium 36.05% and the minimum value of phosphorous 13.10% as compared with N. sativa extract 27.29% and 18.97%, respectively. S. aureus was the most sensitive to the extract of N. sativa with respect to the decrease in the ability to regulate cell permeability, whereas U. lactuca extract was more effective against P. aeruginosa.
Glucose uptake is reflected in the bacterial biomass that determined as dry weight in the untreated cells and directly contrasted with the biomass growth weight analyzed during the incubation period with U. lactuca and N. sativa extracts. The influence of 50 and 100 µl tested extract on the bacterial metabolism expressed as glucose uptake is shown in Table 1. As the concentration of U. lactuca and N. sativa treated extracts increased, glucose uptake was found to be decreased with S. aureus 53.00% and 39.96%, respectively and P. aeruginosa 41.09% and 44.74%, respectively. Therefore, a decrease in glucose uptake was reflected in the less dry weight of treated bacteria with tested extracts. The results in Table 2 clarified that the lowest dry weight of S. aureus 32.59% was observed when treated with N. sativa extract. However, P. aeruginosa showed the minimum dry weight 28.41% during the incubation with U. lactuca extract.
The results of an SEM study showed the changes in the bacterial morphology and structure in response to the methanol extracts of U. lactuca (Figure 3) and N. sativa (Figure 4). The treatment of bacteria with the extract of U. lactuca and N. sativa resulted in the formation of cavities in cells as well as shrinkage, aggregation, rupture, and partial deformation of the cell wall.
(A) (B)
Figure 1. Potassium (A) and phosphorus (B) leakage of S. aureus treated with 100 µl of U. lactuca and N. sativa extract after 20, 40, 60 and 80 minutes of incubation.
(A) (B)
Figure 2. Potassium (A) and phosphorus (B) leakage of P. aeruginosa treated with 100 µl of U. lactuca and N. sativa extract after 20, 40, 60 and 80 minutes of incubation.
Table 1. Glucose uptake ((mg DL-1) of S. aureus and P. aeruginosa treated with 50 and 100 µl U. lactuca and N. sativa extract after 24 hours of incubation (Mean ± SD).
Table 2. Dry weight (mg) of S. aureus and P. aeruginosa treated with 50 and 100 µl U. lactuca and N. sativa extract after 24 hours of incubation (Mean ± SD).
![]()
Figure 3. SEM showed the effect of U. lactuca (A) and N. sativa (B) extracts on the cell wall of S. aureus, compared to control (C).
![]()
Figure 4. SEM showed the effect of U. lactuca (A) and N. sativa (B) extracts on the cell wall of P. aeruginosa , compared to control (C).
3.2. Molecular Analyses
The molecular investigation of the S. aureus antibiotics resistant gene mecA, and P. aeruginosa Acetyl coenzyme A synthetase gene acsA, are found in Figure 5 and Figure 6. Bacteria treated with U. lactuca and N. sativa extract showed changes in the gene sequence of the selected microorganism, compared with the untreated sample.
As shown in Figure 5 for S. aureus, five mismatches and two gaps were observed after treatment with N. sativa, and two mismatches and two gaps were noticed after treatment with U. lactuca. The primer used in this sequence was Mr3. Two gaps occurred in the treatment with the extract of N. sativa in the bases 26 and 432, whereas no gaps occurred in the gene after the treatment with U. lactuca extract for Mr4, there were 4 mismatches after treatment with N. sativa in the bases 165, 186 and 199 after the treatment with N. sativa extract. Furthermore, there was one mismatch in base 501 and one gap in base 504 after treatment with U. lactuca extract.
![]()
Figure 5. S. aureus Mr3 and Mr4 gene detection after treatment with 100 µl of U. lactuca and N. sativa extracts.
![]()
Figure 6. P. aeruginosa F and R in ascA gene detection after treatment with 100 µl of U. lactuca and N. sativa extracts.
Figure 6 showed the results of P. aeruginosa gene acsA sequence, which included one mismatch in the base 379 for the primer acsA F after treatment with N. sativa extract and 2 gaps in the bases 379 and 393 for the primer acsA R, compared with the untreated cells. The results show two mismatches in the bases 394 and 379 and two unread bases for bases 394 and 395 for the primer acsA F and one gap in the base 398 for the primer acsA R after treatment with the extract of U. lactuca.
4. Discussion
Antimicrobial agents can target several parts and processes of a microbe cell, including the cell wall, the cytoplasmic membrane, protein and enzyme production, DNA replication and the DNA genetic code [30] [31] . These alterations are caused by active compounds in the extracts of these medicinal plants, which have been shown to contain bioactive components that act as highly effective antimicrobial agents against microbial infections such as quinine, tannins, terpenoids, sterols, alkaloids and flavonoids [32] [33] [34] .
Several studies that analyzed extracts of medicinal plants such as Rhamnus globosa, Ocimum basilicum, Tecoma stans, Coleus forskohlii, Phoenix dactylifera, N. sativa, Elettaria cardamomum, Lawsonia inermis, Embelia ribes and Santalum album have shown that they contain active compounds that can directly inhibit the growth activity of Gram negative and positive bacteria including Bacillus subtilis, B. cereus, S. aureus, S. aureus MRSA Corynebacterium bovis, Pseudomonas aeruginosa, Pasteurella multocida and E. coli [35] [36] [37] .
It has been shown that N. sativa L. has several pharmacological effects that have been attributed to the active components in the seed extracts including thymoquinone, thymohydroquinone, dithymoquinone, thymol, carvacrol, nigellicine, nigellimine-x-oxide, nigellidine and alpha-hederin [38] [39] . Furthermore, the GC-MS analysis of U. lactuca extracts reveal the existence of phytochemical products such as phytol, hexadecanoic acid, ethyl ester and (E)-9-octa- decenoic acid ethyl ester, thymoquinone, α-thujene, thymohydroquinone, p-cy- mene, dehydro-sabina ketone, carvacrol and longifolene [40] . The antimicrobial activity of U. lactuca has been verified by the studies with several pathogenic microorganisms including K. pneumonia, E. coli, E. aerogens, P. aeruginosa, M. luteus, E. faecalis, S. aureus, S. aureus, MRSA, S. faecalis and B. subtilis [41] [42] [43] . Moreover, the increase in potassium and phosphorus leakage returned to the effect of the extract on the permeability of the cytoplasmic membrane, as verified by SEM. In addition, the rate of gene mutation was shown to be higher in tested bacteria treated with U. lactuca and N. sativa extract [5] [27] [44] [45] [46] .
5. Conclusion
The present study concluded that the extract of the green alga, U. lactuca and the seeds of medicinal plant, N. sativa can be used as a source for antibacterial agent. Further works should be done for isolation and characterization of the active compounds.