Isolation and Identification of Fungal Endophytes from Grasses along the Oregon Coast

Abstract

Fungal endophytes have been shown to improve abiotic and biotic stress response in plants. Grasses growing along the Oregon coast are exposed to harsh conditions and may harbor endophytes that enable them to survive and grow under these conditions. Endophytic fungi were isolated from thirty-four grass plants representing eight different grass species at four different locations along the Oregon coast. The ITS-1, 5.8S, and ITS-2 regions of each isolate were amplified, sequenced, and used to perform a BLAST search against the nucleotide database collection at National Center for Biotechnology Information. One-hundred-eleven different fungal isolates were classified into thirtynine genera with two isolates that did not show a match greater than 95%. These endophytes will be investigated to determine their potential for improving the adaptability of grasses and other crop plants to grow in diverse environments where they are subjected to multiple biotic and abiotic stresses.

Share and Cite:

Martin, R. and Dombrowski, J. (2015) Isolation and Identification of Fungal Endophytes from Grasses along the Oregon Coast. American Journal of Plant Sciences, 6, 3216-3230. doi: 10.4236/ajps.2015.619313.

Received 30 September 2015; accepted 13 December 2015; published 16 December 2015

1. Introduction

It is estimated that the human population will reach nine billion by 2050. This population increase combined with climate change will require an increase in food production under less than optimal conditions. In the mid- late 20th century, the “Green Revolution” was the result of breeding efforts aimed at improved crop cultivars, the introduction of hybrids, and increased agricultural inputs in terms of fertilizer, pesticides, water, herbicides and crop management practices. We are now facing a similar global food security challenge that will require continued improvements in crop yields and agricultural production practices. Climate change and the expansion of agricultural production to marginal lands will also require innovative ways to increase abiotic and biotic stress tolerance and improve nutrient uptake efficiency in crop plants to meet future global food demands.

Many plants contain endophytic organisms that Wilson (1995) defined as “fungi or bacteria which, for all or part of their life cycle, invade the tissues of living plants and cause unapparent and asymptomatic infections entirely within plant tissues but cause no symptoms of disease” [1] . Fungal endophytes are known to produce antibacterial substances [2] and have been shown to improve the tolerance of host plants to a variety of biotic and abiotic stresses [3] - [5] . The presence of fungal endophytes has been shown to increase the survival and persistence of their host plants in a diverse range of environments and may also protect them from insects, pathogens, and herbivores. Neoptyphodium sp., members of Clavicipitaceae group of fungi, infects grasses and has been extensively studied because of their significant impact on agriculture. This fungal species produces alkaloids which are toxic to livestock and can limit the utility of these grasses in forage and pasture applications [6] - [9] . However, the alkaloids and other metabolites produced by these endophytes [10] - [15] also provide benefits to their host by increasing resistance to insects [16] [17] , grubs [18] and nematodes [19] [20] , enhancing nutrient uptake [4] and increasing drought tolerance [21] . In addition to metabolites, the symbiotic relationship results in the increased production of reactive oxygen species (ROS), which may be critical to maintaining the mutualistic fungal/plant interaction [22] . This increase in ROS is thought to provide oxidative stress protection by stimulating the host’s antioxidant pathways [22] - [24] that facilitate enhanced biotic and abiotic stress tolerance for the host plant. In addition to these pathways, there are likely many other unidentified mechanisms associated with the symbiosis that is beneficial to the plant’s and endophyte’s survival.

Although less well studied, another group of endophytes that also have been shown to provide enhanced abiotic and biotic stress tolerance to their hosts, is the nonclavicipitaceous fungal endophytes of the subkingdom Dikarya [25] . This group has a greater diversity of species that are able to colonize multiple plant tissues in a wider range of host plants than their Neotyphodium counterparts. In some cases, the benefit to both symbionts is obvious, as neither the host nor the endophyte is able to survive individually under stress conditions that they can survive when in symbiosis with each other [26] . The endophyte Fusarium culmorum, isolated from dunegrass growing in coastal habitats, has been shown to be necessary for salt tolerance of this plant [25] . Furthermore, when this endophyte was inoculated into tomato and rice, it imparted salt tolerance to these plants [25] [27] . The fungal endophyte Curvularia protuberate (and its associated virus), which were isolated from Dichanthelium lanuginosum (panic grass) growing near geothermal regions in Lassen Volcanic and Yellowstone National Parks [26] , was able to confer heat tolerance when inoculated into panic grass and tomato [25] . Interestingly, endophytes from both locations were able to confer drought tolerance to infected plants. The increased tolerance of these plants correlated with lower levels of ROS in leaves of the symbionts when exposed to stress, possibly due to endophytes scavenging ROS or altering the plant’s production or scavenging of ROS. The authors coined the term “habitat-adapted symbiosis” to describe this ability of fungi isolated from plants in a specific habitat to confer habitat-specific stress tolerance to those plants [25] .

Another endophytic fungus currently being explored for agricultural potential, Piriformospora indica, was first isolated from xerophytes growing in a desert in India [28] . It was later shown to promote growth and increase biomass in a wide range of plants [29] - [31] , induce resistance against pathogens in barley, wheat, Arabidopsis and tomato [30] [32] [33] , increase abiotic stress tolerance of plants [34] [35] , and reduce egg density of the parasitic soybean cyst nematode [36] . Interestingly, changes in plant hormone homeostasis were suggested to be important for this fungal endophyte to colonize different plant species [37] [38] . Furthermore, it was shown that enzymes involved in the antioxidant pathway were critical for increased biotic and abiotic stress resistance in the presence of P. indica [31] [32] [35] [39] - [42] . This endophyte shows great potential for increasing abiotic and biotic stress tolerance and increasing biomass and seed production in multiple plant species (for review see [43] ).

Many of the endophytes described above have been identified in plants that are exposed to abiotic and biotic stresses. Grasses growing along the Oregon coast are exposed to salinity stress as well as other abiotic and biotic stresses. In order to survive in this demanding environment, these grasses may contain a unique population of fungal endophytes. The long-term goal of this study is to isolate fungal endophytes associated with these grasses that have the potential to enhance plant growth/biomass and/or impart abiotic and biotic stress tolerance to forage, turf, and energy-related grasses and/or other plant species. This paper describes the initial isolation and identification of fungal endophytes from various grasses growing in sandy soils and exposed to ocean spray and mist along the Oregon coast.

2. Materials and Methods

2.1. Sample Collection and Fungal Isolation

Samples (root crown, leaves, and stems) were collected from grasses growing in areas exposed to ocean spray, mists and tides along the Oregon coast. Grasses were collected from sites near Harbor Vista (Lat/Long 44.021629 - 124.133127), Coos Bay (Lat/Long 43.366501 - 124.217888), Bob Creek Wayside (Lat/Long 44.244493 - 124.111582), and Yachats (Lat/Long 44.3105 - 124.103976) (Table 1). Grass species that are present in the Willamette Valley were preferentially selected. At each site, attempts were made to collect different grass species, and within each species, 1-3 individuals were collected from different locations within each site.

Samples were stored in plastic bags in a cooler with ice during collection and refrigerated until processing for endophyte isolation. All samples were processed within 48 h of collection. Samples were rinsed with water to remove soil and debris, swirled in a beaker containing distilled water and two drops of Tween 20/100 ml, and rinsed again prior to cutting the tissue. Any dead plant tissue and most of the roots were removed from the plant, and the remaining plant was dissected into tissues corresponding to the root crown (1 - 1.5 cm), leaves (4 - 6 cm in length), and stems (4 - 6 cm in length) prior to surface sterilization. After plant tissues were visibly clean, the tissues were rinsed in tap deionized water and then placed between damp paper towels to prevent them from drying out until tissues were sterilized prior to plating for fungal isolation. Stems and root crowns were surface sterilized by placing the tissue in 90% ethanol for 1 min, 3% sodium hypochlorite (from bleach) with 2 drops of Tween-20/100 ml for 3 min, sterile double distilled water (DDW) for 1 min, 70% ethanol for 1 min, and a quick

Table 1. Plant ID # and identification of grasses collected at designated locations.

rinse in sterile DDW. Leaf tissue was sterilized by placing leaves in 70% ethanol for 2 min, 2% sodium hypochlorite (from bleach) for 3 min, sterile DDW for 1 min, followed by a quick dip in 90% ethanol. After sterilization, the end (~2 - 3 mm) of stem, leaf or root crown was cut off and discarded. The remaining sample was cut into 2 - 3 mm sections and divided between two plates containing either Bacto™ Potato Dextrose Agar (PDA) or BBL™ Corn Meal Agar with added Malt (1 g/L) and Yeast Extract (2 g/L) (CMMY) (Becton, Dickinson & Co; Sparks, MD) containing 50 mg/L of carbenicillin and streptomycin. Plates were incubated at room temperature and examined for emerging fungi every 2 - 3 days. As fungi emerged, they were transferred to PDA plates to obtain pure cultures. Prior to initial plating, several samples were imprinted onto media and these imprinted plates were monitored for lack of fungal growth to ensure the effectiveness of the sterilization technique [44] .

2.2. DNA Extraction and ITS Sequencing

DNA was extracted from pure cultures following the simple miniprep method of Saitoh et al. [45] . A piece of mycelia about the size of a half dime was removed from the plate and placed into 500 μl of Lysis Buffer (200 mM Tris, 50 mM EDTA, 200 mM NaCl, 1% N-lauroylsarcosine-Na salt, pH 8.0). The tissue was lightly homogenized using disposable pestles. Samples were allowed to sit for approximately an hour at room temperature to allow for processing of multiple samples at a time. Samples were centrifuged for 5 min at max speed in an Eppendorf 5417C centrifuge. Approximately 300 μl of supernatant was removed to a new tube containing 750 μl of 100% ethanol. Samples were vortexed gently and stored at −20˚C overnight. Samples were centrifuged for 5 min at 13,000 ×g, the supernatant decanted, and the pellet was washed with 70% ethanol. The pellet was suspended in 100 μl of TE buffer (10 mM Tris, 1 mM EDTA, pH 8.0).

The rDNA ITS region was amplified by PCR with primers ITS5 (GGAAGTAAAAGTCGTAACAAGG) and ITS4 (TCCTCCGCTTATTGATATGC) [46] . The amplicons include the ITS1, 5.8S and ITS2 region of rDNA and most amplicons were ~500-650 base pairs in length. The DNA was amplified using PrimeSTAR™ HS DNA Polymerase (Takara Clonetech, Madison, WI) following the manufacturer’s instructions. The PCR reaction mix consisted of 1× PrimeSTAR buffer, 0.2 mM each dNTP’s, 0.3 μM primers, ~20 ng of DNA, and 1.25 U PrimeSTAR HS DNA Polymerase in a final volume of 50 μl. Amplification was performed on an MJ Research PTC 200 or a Bio-Rad DNA Engine Peltier thermal cycler (BioRad; Hercules, CA) with the following program: 96˚C for 4 min; 35 cycles of 98˚C for 10 s, 57˚C for 5 s, 72˚C for 45 s; and a final 10 min extension at 72˚C; and then kept at 4˚C until removal. The PCR products (8 μl) were run on a 1.5% TAE agarose gel to analyze purity. Products with a single band were purified with the AccuPrep® PCR Purification kit (Bioneer, CA); and products with multiple bands were run on a 1.5% TAE agarose gel and purified using the Accuprep® Gel Purification Kit (Bioneer, CA). PCR products were sequenced on an ABI Prism® 3730 Genetic Analyzer at the Center for Genome Research and Biocomputing at Oregon State University or at Genscript USA Inc. (Piscataway, NJ). Sequences were submitted to a Targeted (Internal transcribed spacer region [ITS] from fungi type and reference material) Nucleotide Basic Local Alignment Search Tool (BLAST) Megablast (Optimize for highly similar sequences) and to a standard nucleotide nr/nt database BLAST against the nt collection at National Center for Biotechnology Information (NCBI, GenBank; www.ncbi.nih.gov) [47] [48] .

2.3. Testing for Antibacterial Activity of Select Samples

A representative sample from each clade of the phylogenetic tree from the Megablast search results was tested for antibiotic production. Fungi were grown on plates without any antibiotics for 7 - 14 days. Bacteria (Frigoribacterium [Frig] and Bacillus, also collected from coastal grasses) were grown overnight in LB media, diluted 1:20 in LB, and then spread as a lawn on LB/PDA agar plates (500 mls; 2.5 g peptone, 1.25 g yeast extract, 2.5 g NaCl, 3.75 g agar, pH 6.5). A cork borer was used to remove 3 plugs (~7 mm in diameter) from each plate. A comparable sized plug of the fungus to be tested for antibiotic activity was placed into two of the bacterial plate holes and a negative media plug (no fungus) was placed in the third hole. Bacteria were allowed to grow for 24 - 48 h and then the plate was examined for the presence of zones of bacterial growth inhibition next to the fungal plug.

3. Results and Discussion

Thirty-four different plant samples were collected from various sites along the Oregon coast; four from Coos Bay, 14 from Harbor Vista, nine from Bob Creek Wayside, and seven from Yachats (Table 1). Only plants that were exposed to ocean spray, mist and tidal water were collected for this experiment. Each plant was divided into root crown, stem and leaf; surface sterilized, and then cut into ~0.5 cm pieces and cultured on PDA and CMMY agar plates. Lack of fungal growth on tissue imprint plates indicated that the sterilization technique was sufficient to remove epiphytic fungi. It is possible that the sterilization was too harsh, and that more isolates could have been obtained with a less harsh method of sterilization. A total of 140 fungi were isolated from 34 different plants. After duplicate isolates (based on the ITS sequence, plant isolate number and culture morphology) from each individual plant segment (same fungi on the different media and from leaf, stem or root crown of the same plant) were eliminated, there were 111 different isolates remaining. Further elimination of identical isolates from within the same plant (same isolate found in either the root crown, stem and/or leaf) resulted in 107 distinct isolates from all plant samples at all locations. Based on the ITS sequence and culture morphology, the fungal isolates were classified into thirty-nine different genera, and two additional isolates designated as “unknown fungi” with sequences that did not have any BLAST hits with greater than 95% identity.

The distribution of the fungal isolates at different locations is listed in Table 2. Some isolates are listed under a broader classification rather than a specific genera (Ascomycete sp., Hypocreales sp., Mucorales sp.) and in these cases the top BLAST hits were not associated with a genus, but were simply classified as belonging to the indicated group. Some species, such as Fusarium and Ascomycota sp., were found at all locations, while many genera were only isolated from plants at one of the locations (see Table 2, gray highlighted samples). Overall, two to three fungi were isolated from each plant at Bob Creek Wayside and Harbor Vista. Interestingly, while fewer plants were collected at Coos Bay, the plants that were collected averaged more fungal isolates per plant (~5.5) (Table 2) than plants from other areas (~2.5 - 4.1 isolates/plant). The Coos Bay site was more remote and there were no cultivated grasses growing in close proximity to the collection site. This was not the case at Bob Creek Wayside and Yachats, and in these areas some samples could have been escapes from cultivated grasses. This could potentially affect the types of endophytes and grasses isolated from each area.

The distribution of fungal isolates in the different grass species is presented in Table 3. While only one Deschampsia specimen was collected, this plant had the greatest number of fungal isolates associated with it. Hordeum and Amophilia also had slightly greater than average number of isolates, while only one fungal isolate was isolated from Lolium. Fungal isolates from both the Clavicipitaceous and the nonclavicipitaceous groups were isolated from these grass species (Table 3). Interestingly, clavicipitaceous fungi were isolated from Festuca sp. at Harbor Vista (Cf. Acremonium sp. and Neotyphodium sp.) and at Bob Creek Wayside (Epichloe sp.), but were not found in other grass species or at the other locations. There were 18 additional fungal isolates from the order Hypocreales, including multiple isolates most closely aligned to Fusarium, Sarocladium, and Septoriella from several grass species (Table 3) and individual isolates most closely related to Beauveria (from Amophilia sp.), Chaunopycnis (from Hordeum sp.), Isaria (from Bromus), and Trichoderma (from Amophilia). There were 32 different isolates from the order Pleosporales with eight isolates of Phaeosphaeria and seven of Stemphylium, five of Alternaria, three of Phoma and one or two of Drechslera, Embellisia, Paraphaeosphaeria, Pleospora and Saccharicola. Representatives of the Dothideales order were found at all locations and included two Aureobasidium sp. and five Pseudoseptoria isolates. A few fungi closely related to members of the order Heliotales (Helgardia and Articulospora) and Mucorales (Umbelopsis and Mucorales sp.) were also isolated from Festuca. Overall, fungal isolates collected were placed into five different orders based on their ITS sequences. A complete list of all unique isolates and the corresponding accession number for the top hit used to identify each isolate from the NCBI BLAST results can be found in Table 4.

3.1. Antibacterial Activity of Select Samples

Fungal endophytes are known to produce many secondary metabolites, some with antimicrobial activity (reviewed in [49] ). The ITS sequence from isolates in this study were subjected to a targeted MOLE-BLAST search against “Internal transcribed spacer region [ITS] from fungi type and reference material” and the isolates were separated into 19 different loci (data not shown). At least one representative fungi from each loci was chosen to examine its potential for inhibiting bacterial growth of two bacteria, Frig and Bacillus sp., which were also isolated from grass species from this study. Preliminary results using fungal plug inhibition of bacterial growth revealed inhibition by representatives of Penicillium sp. (isolate from Coos Bay plant 2 and Harbor Vista plant 11), Phlebia sp. (from Bob Creek Wayside Plant 3), Heterobasidium sp. (from Harbor Vista plant 11),

Table 2. Fungal isolates (based on BLAST results) collected at each site. Isolates present at only one site are gray shaded. Only isolates that had BLAST sequence targets that were greater than 97% identical to test sequences are presented.

Table 3. Number of fungi of designated genera isolated and identified by ITS sequencing from each species at all locations. Only isolates that had BLAST sequence targets that were greater than 97% identical to test sequences are presented. The last column represents the order to which the fungi belongs.

*Abbreviations: Br (Bromus), Am (Amophilia), Fe (Festuca), Ho (Hordeum), Ph (Phalaris), Ag (Agrostis), Lo (Lolium), De (Descampsia).

Table 4. List of unique isolates from each plant at each site, and identification of the most closely related species identified using the ITS sequence to perform an nr/nt BLAST search at the National Center for Biotechnology Information. Isolate designation refers to location (BS, CB, HV, YH); plant number (1-14); tissue type (L, SS, RC); and the final letter/number refers to different isolates from the specific sample. BS (Bob Creek Wayside), CB (Coos Bay), HV (Harbor Vista), YH (Yachats), L (leaf), RC (Root Crown), SS (stem).

Phaeosphaeria sp. (from Harbor Vista plant 14) and Aureobasidium sp. (from Yachats plant 2). Penicillium species were initially included in the study as a potential positive control for the assay, because it is the source of the common antibiotic penicillin, and was expected to be positive.

Another isolate obtained from Festuca at Harbor Vista was also able to inhibit growth of Frig and Bacillus and based on the ITS sequence, this isolate was most closely related to a species of Phaeosphaeria. Interestingly, antibacterial activity of phaeosphenone, a compound isolated from Phaeosphaeria, has been previously reported [50] . Phlebia sp., which was isolated from Bromus growing at Bob Creek Wayside, was also able to inhibit the growth of these bacteria. Phlebia species produce several merulinic acids which show antimicrobial activity to multiple bacterial species [51] . Heterobasidion sp. are probably most recognized as the causal agent of rot in forest trees, however Heterobasidion has also been isolated as an endophyte in chili pepper [52] . An isolate from Bromus sp. at Harbor Vista was identified as Heterobasidion sp. based on the IT sequence homology and was shown to inhibit bacterial growth of Bacillus and Frig. Antibiosis has previously been associated with secondary metabolites of Heterobasidion annosum [53] . Another fungus, Exophiala pisciphila (which was later identified as Aureobasidium pullulans) produces exophilin A, which has antimicrobial activity against gram positive bacteria [54] . More recent studies have focused on novel types of antibacterial liamocins from various strains of Aureobasidium pullulans grown on different types of growth media and their antibacterial activity [55] . A fungal species isolated from Bromus sp. in Yachats, which based on ITS sequence was most closely related to Aureobasidium sp., inhibited growth of Bacillus and Frig in our studies. Several other isolates were tested, but they showed little or no inhibition of bacterial growth. The antibiosis observed in selected isolates indicates that these endophytes may be a source for other valuable secondary metabolites.

3.2. Potential of Fungal Endophytes Collected in This Study

Fungi can form different types of associations with plants, some beneficial and some harmful. Parasitic, saprophytic and pathogenic fungi can be very deleterious to a plant, while endophytes and mycorrhizal fungi are considered beneficial symbionts which promote plant growth, confer enhanced resistance to various pathogens and pests, and improve survival under unfavorable environmental conditions [4] [5] [25] (reviewed in [56] ). Several endophytes identified in this study have previously been shown to promote plant growth under normal and/or stressed conditions. In endophyte growth promoting studies in switchgrass, six different endophytes, including two genera, Phaeosphaeria pontiformis and Alternaria sp., isolated in our study, increased total biomass of switchgrass seedlings following inoculation. Several other endophytes, including some known crop pathogens isolated from asymptomatic switchgrass plants, decreased biomass when tested in greenhouse conditions [57] . Interestingly, in these switchgrass studies, some species of Alternaria promoted growth while others inhibited growth. Other endophytes isolated in this study belong to genera previously shown to promote plant growth including Fusarium, Cladosporium, Phoma, Aspergillus sp., Chaetomium, Aureobasidium, Exophilia and Trichoderma (reviewed in [58] ).

Several other studies have described the isolation of endophytes from plants growing in salt stressed or harsh environments. As mentioned earlier, Fusarium culmorum, isolated from dunegrass growing in coastal habitats, has been shown to be necessary for salt tolerance of this plant [25] [27] . Interestingly, filtrates from Penicillium endophytes isolated from a dune plant (Ixeris repenes) and from a salt marsh plant (Suaeda japonica Makino), both determined to be gibberellin producing fungi, promoted growth when applied to test plants [59] [60] . Fungal endophytes (Cladosporium sp., Penicillium sp., and Pyrenochaeta sp.) isolated from roots of wild barley species growing under shallow, alkaline, salty and dry soil conditions, increased grain yield and shoot biomass of cultivated barley, and interestingly these benefits were more evident when plants were grown under low nutrient conditions [61] . In earlier studies, endophytes from wild barley were shown to be antagonistic to seed- borne infections when inoculated onto seeds [62] . Species of Sarocladium have been reported as endophytes in other grass species [63] [64] and as a beneficial endophyte in maize which produces antibiotics inhibitory to Aspergillus flavus and Fusarium verticillioides [65] [66] . However, Sarocladium sp. are also known to cause rice sheath rot disease [67] and wilts in other species.

Schultz et al. [68] described the host/endophyte association as “A balanced antagonism”. It is interesting to note that some endophytes may be latent pathogens that could become pathogenic later when the host plant/ fungal association is no longer beneficial to the endophyte, as is the case with an oak endophyte, Discula quercina [69] . Some of the putative fungal endophytes isolated in this study belong to species that are known pathogens and would not be considered for future studies without eliminating that possibility through further molecular analysis. Future studies will focus on testing these endophytes for their ability to increase abiotic/biotic stress tolerance in grass species. Additional isolation of endophytes from grasses at different times during their growth cycle and from areas more remote to human activity could also be beneficial for expanding this endophyte collection. This endophyte collection will allow us to begin evaluating their potential for increasing agricultural production in a sustainable, environmentally friendly manner.

4. Conclusion

Grasses provide forage and ecological benefits that contribute significantly to our agricultural, environmental, economic, and social well-being. Grasses are a valuable forage species, but are also becoming more important as buffers for watersheds, habitat for biologically diverse plants and animals, and as sinks for carbon sequestration. Adaptable, high-yield, low-input grass varieties and management strategies are needed to enhance the utility of these grasslands and to meet the goals of improved food and energy security. The Willamette Valley of Oregon produces over 50% of the world’s cool season grass seed. The presence of fungal endophytes in grasses has been shown to improve the persistence and productivity of grasses when challenged with abiotic and biotic stresses, but information about the potential for isolating and adapting new endophytes from other grasses to improve rangeland, pasture, turf and bioenergy grasses is limited. The purpose of this study is to identify novel fungal endophytes that are native to Oregon that will allow us to improve grass stress tolerance without using direct genetic modification and without introducing foreign or exotic species into this diverse agricultural production area. The discovery of novel endophytes has the potential to improve yield and persistence, as well as increase the adaptability of these grasses to multiple stresses encountered in end-use environments.

Acknowledgements

Special thanks is extended to Thomas Lockwood, Stephanie Samard, and Lori Evans-Marks (USDA-ARS FSCRU, Corvallis Oregon) for their assistance in processing plant and fungal samples, and Richard Halse at Oregon State University for his help in identification of grasses. Experimental methods performed in this research complied with current laws and regulations of the USA. Mention of trademark, vendor, or corporation names in this publication is for the information and convenience of the reader. Such use does not constitute an official endorsement or approval by the United States Department of Agriculture or the Agricultural Research Service of any product or service to the exclusion of others that may be suitable.

NOTES

*Corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

References

[1] Wilson, D. (1995) Endophyte: The Evolution of a Term and Clarification of Its Use and Definition. Oikos, 73, 274-276.
http://dx.doi.org/10.2307/3545919
[2] Radic, N. and Strukelj, B. (2012) Endophytic Fungi—The Treasure Chest of Antibacterial Substances. Phytomedicine, 19, 1270-1284.
http://dx.doi.org/10.1016/j.phymed.2012.09.007
[3] Bacon, C.W., Richardson, M.D. and White Jr., J.F. (1997) Modification and Uses of Endophyte-Enhanced Turfgrasses: A Role for Molecular Technology. Crop Science, 37, 1415-1425.
http://dx.doi.org/10.2135/cropsci1997.0011183X003700050001x
[4] Malinowski, D.P. and Belesky, D.P. (2000) Adaptations of Endophyte-Infected Cool-Season Grasses to Environmental Stresses: Mechanisms of Drought and Mineral Stress Tolerance. Crop Science, 40, 923-940.
http://dx.doi.org/10.2135/cropsci2000.404923x
[5] Rodriguez, R.J., Redman, R.S. and Henson, J.M. (2004) The Role of Fungal Symbioses in the Adaptation of Plants to High Stress Environments. Mitigation and Adaptation Strategies for Global Change, 9, 216-272.
http://dx.doi.org/10.1023/B:MITI.0000029922.31110.97
[6] Bacon, C.W., Porter, J.K., Robbins, J.D. and Luttrell, E.S. (1977) Epichloë typhina from Tall Fescue Grasses. Applied and Environmental Microbiology, 34, 576-581.
[7] Lyons, P.C., Plattner, R.D. and Bacon, C.W. (1986) Occurrence of Peptide and Clavine Ergot Alkaloids in Tall Fescue. Science, 232, 487-489.
http://dx.doi.org/10.1126/science.3008328
[8] Saikkonen, K., Gundel, P.E. and Helander, M. (2013) Chemical Ecology Mediated by Fungal Endophytes in Grasses. Journal of Chemical Ecology, 39, 962-968.
http://dx.doi.org/10.1007/s10886-013-0310-3
[9] Schardl, C.L., Leuchtmann, A. and Spiering, M.J. (2004) Symbioses of Grasses with Seedborne Fungal Endophytes. Annual Review of Plant Biology, 55, 315-340.
http://dx.doi.org/10.1146/annurev.arplant.55.031903.141735
[10] Bush, L.P., Wilkinson, H.H. and Schardl, C.L. (1997) Bioprotective Alkaloids of Grass-Fungal Endophyte Symbioses. Plant Physiology, 114, 1-7.
[11] Clay, K. (1988) Fungal Endophytes of Grasses: A Defensive Mutualism between Plants and Fungi. Ecology, 69, 10-16.
http://dx.doi.org/10.2307/1943155
[12] Clay, K. and Schardl, C.L. (2002) Evolutionary Origins and Ecological Consequences of Endophyte Symbiosis with Grasses. American Naturalist, 160, S99-S127.
http://dx.doi.org/10.1086/342161
[13] Saikkonen, K., Gundel, P.E. and Helander, M. (2013) Chemical Ecology Mediated by Fungal Endophytes in Grasses. Journal of Chemical Ecology, 39, 962-968.
http://dx.doi.org/10.1007/s10886-013-0310-3
[14] Schardl, C.L., Young, C.A., Faulkner, J.R., Florea, S. and Pan, J. (2012) Chemotypic Diversity of Epichloae Fungal Symbionts of Grasses. Fungal Ecology, 5, 331-344.
http://dx.doi.org/10.1016/j.funeco.2011.04.005
[15] Blankenship, J.D., Spiering, M.J., Wilkinson, H.H., Fannin, F.F., Bush, L.P. and Schardl, C.L. (2001) Production of Loline Alkaloids by the Grass Endophyte, Neotyphodium uncinatum, in Defined Media. Phytochemistry, 58, 395-401.
http://dx.doi.org/10.1016/S0031-9422(01)00272-2
[16] Clement, S.L., Kaiser, W.J. and Eichenseer, H. (1994) Acremonium Endophytes in Germplasms of Major Grasses and Their Utilization for Insect Resistance. In: Bacon, C.W. and White, J.F., Eds., Biotechnology of Endophytic Fungi of Grasses, CRC Press, Boca Raton, 185-199.
[17] Siegel, M.R., Dahlaman, D.L. and Bush, L.P. (1989) The Role of Endophytic Fungi in Grasses: New Approaches to Biological Control of Pests. In: Leslie, A.R. and Metcalf, R.L., Eds., Integrated Pest Management for Turfgrass and Ornamentals, USA-EPA, Washington DC, 169-186.
[18] Rostás, M., Cripps, M.G. and Silcock, P. (2015) Aboveground Endophyte Affects Root Volatile Emission and Host Plant Selection of a Belowground Insect. Oecologia, 177, 487-497.
http://dx.doi.org/10.1007/s00442-014-3104-6
[19] West, C.P., Izekor, W., Oosterhuis, D.M. and Robbins, R.T. (1988) The Effect of Acremonium coenophialum on the Growth and Nematode Infestation of Tall Fescue. Plant Soil, 112, 3-6.
http://dx.doi.org/10.1007/BF02181745
[20] Kimmons, C.A., Gwinn, K.D. and Bernard, E.C. (1990) Nematode Reproduction on Endophyte-Infected and Endophyte-Free Tall Fescue. Plant Disease, 74, 757-761.
http://dx.doi.org/10.1094/PD-74-0757
[21] Gibert, A., Volaire, F., Barre, P. and Hazard, L. (2012) A Fungal Endophyte Reinforces Population Adaptive Differentiation in its Host Grass Species. New Phytologist, 194, 561-571.
http://dx.doi.org/10.1111/j.1469-8137.2012.04073.x
[22] Tanaka, A., Christensen, M.J., Takemoto, D., Park, P. and Scott, B. (2006) Reactive Oxygen Species Play a Role in Regulating a Fungus-Perennial Ryegrass Mutualistic Interaction. Plant Cell, 18, 1052-1066.
http://dx.doi.org/10.1105/tpc.105.039263
[23] White, J.F. and Torres, M.S. (2010) Is Plant Endophyte-Mediated Defensive Mutualism the Result of Oxidative Stress Protection? Physiologia Plantarum, 138, 440-446.
http://dx.doi.org/10.1111/j.1399-3054.2009.01332.x
[24] Hamilton, C.E., Gundel, P.E., Helander, M. and Saikkonen, K. (2012) Endophytic Mediation of Reactive Oxygen Species and Antioxidant Activity in Plants: A Review. Fungal Diversity, 54, 1-10.
http://dx.doi.org/10.1007/s13225-012-0158-9
[25] Rodriguez, R.J., Henson, J., Van Volkenburgh, E., Hoy, M., Wright, L., Beckwith, F., Kim, Y.-O. and Redman, R.S. (2008) Stress Tolerance in Plants via Habitat-Adapted Symbiosis. International Society for Microbial Ecology Journal, 2, 404-416.
http://dx.doi.org/10.1038/ismej.2007.106
[26] Redman, R.S., Sheehan, K.B., Stout, R.G., Rodriguez, R.J. and Henson, J.M. (2002) Thermotolerance Generated by Plant/Fungal Symbiosis. Science, 298, 1581.
[27] Redman, R.S., Kim, Y.O., Woodward, C.J.D.A., Greer, C., Espino, L., Doty, S.L. and Rodriguez, R.J. (2011) Increased Fitness of Rice Plants to Abiotic Stress via Habitat Adapted Symbiosis: A Strategy for Mitigating Impacts of Climate Change. PLoS ONE, 6, e14823.
http://dx.doi.org/10.1371/journal.pone.0014823
[28] Verma, S., Varma, A., Rexer, K.-H., Hassel, A., Kost, G., Sarabhoy, A., Bisen, P., Bütenhorn, B. and Franken, P. (1998) Piriformospora indica, gen. et sp.nov., a New Root-Colonizing Fungus. Mycologia, 90, 896-903.
http://dx.doi.org/10.2307/3761331
[29] Varma, A., Verma, S., Sudha, Sahay, N., Bütehorn, B. and Franken, P. (1999) Piriformospora indica, a Cultivable Plant-Growth-Promoting Root Endophyte. Applied and Environmental Microbiology, 65, 2741-2744.
[30] Fakhro, A., Andrade-Linares, D.R., von Bargen, S., Bandte, M., Buttner, C., Grosch, R., Schwarz, D. and Franken, P. (2010) Impact of Piriformospora indica on Tomato Growth and on Interaction with Fungal and Viral Pathogens. Mycorrhiza, 20, 191-200.
http://dx.doi.org/10.1007/s00572-009-0279-5
[31] Prasad, R., Kamal, S., Sharma, P.K., Oelmüller, R. and Varma, A. (2013) Root Endophyte Piriformospora indica DSM 11827 Alters Plants Morphology, Enhances Biomass and Antioxidant Activity of Medicinal Plant Bacopa monniera. Journal of Basic Microbiology, 53, 1016-1024.
http://dx.doi.org/10.1002/jobm.201200367
[32] Waller, F., Achatz, B., Baltruschat, H., Fodor, J., Becker, K., Fischer, M., Heier, T., Hückelhoven, R., Neumann, C., von Wettstein, D., Franken, P. and Kogel, K.-H. (2005) The Endophytic Fungus Piriformospora indica Reprograms Barley to Salt-Stress Tolerance, Disease Resistance, and Higher Yield. Proceedings of the National Academy of Sciences of the United States of America, 102, 13386-13391.
http://dx.doi.org/10.1073/pnas.0504423102
[33] Sun, C., Shao, Y., Vahabi, K., Lu, J., Bhattacharya, S., Dong, S., Yeh, K.W., Sherameti, I., Lou, B., Baldwin, I.T. and Oelmüller, R. (2014) The Beneficial Fungus Piriformospora indica Protects Arabidopsis from Verticillium dahlia Infection by Downregulation Plant Defense Responses. BMC Plant Biology, 14, 268.
http://dx.doi.org/10.1186/s12870-014-0268-5
[34] Sherameti, I., Tripathi, S., Varma, A. and Oelmüller, R. (2008) The Root-Colonizing Endophyte Pirifomospora indica Confers Drought Tolerance in Arabidopsis by Stimulating the Expression of Drought Stress-Related Genes in Leaves. Molecular Plant-Microbe Interactions, 21, 799-807.
http://dx.doi.org/10.1094/MPMI-21-6-0799
[35] Sun, C.A., Johnson, J.M., Cai, D., Sherameti, I., Oelmüller, R. and Lou, B. (2010) Piriformospora indica Confers Drought Tolerance in Chinese Cabbage Leaves by Stimulating Antioxidant Enzymes, the Expression of Drought-Related Genes and the Plastid-Localized CAS Protein. Journal of Plant Physiology, 167, 1009-1017.
http://dx.doi.org/10.1016/j.jplph.2010.02.013
[36] Bajaj, R., Hu, W., Huang, Y.Y., Chen, S., Prasad, R., Varma, A. and Bushley, K.E. (2015) The Beneficial Root Endophyte Piriformospora indica Reduces Egg Density of the Soybean Cyst Nematode. Biological Control, 90, 193-199.
http://dx.doi.org/10.1016/j.biocontrol.2015.05.021
[37] Schäfer, P., Pfiffi, S., Voll, L.M., Zajic, D., Chandler, P.M., Waller, F., Scholz, U., Pons-Kühnemann, J., Sonnewald, S., Sonnewald, U. and Kogel, K-H. (2009) Manipulation of Plant Innate Immunity and Gibberellins as Factor of Compatibility in the Mutualistic Association of Barley Roots with Piriformospora indica. Plant Journal, 59, 461-474.
http://dx.doi.org/10.1111/j.1365-313X.2009.03887.x
[38] Schäfer, P., Pfiffi, S., Voll, L.M., Zajic, D., Chandler, P.M., Waller, F., Scholz, U., Pons-Kühnemann, J., Sonnewald, S., Sonnewald, U. and Kogel, K.-H. (2009) Phytohormones in Plant Root-Piriformospora indica Mutualism. Plant Signaling and Behavior, 4, 669-671.
http://dx.doi.org/10.4161/psb.4.7.9038
[39] Baltruschat, H., Fodor, J., Harrach, B.D., Niemczyk, E., Barna, B., Gullner, G., Janeczko, A., Kogel, K.H., Schäfer, P., Schwarczinger, I., Zuccaro, A. and Skoczowski, A. (2008) Salt Tolerance of Barley Induced by the Root Endophyte Piriformospora indica Is Associated with a Strong Increase in Antioxidants. New Phytologist, 180, 501-510.
http://dx.doi.org/10.1111/j.1469-8137.2008.02583.x
[40] Vadassery, J., Tripathi, S., Prasad, R., Varma, A. and Oelmüller, R. (2009) Monodehydroascorbate Reductase 2 and Dehydroascorbate Reductase 5 Are Crucial for a Mutualistic Interaction between Piriformospora indica and Arabidopsis. Journal of Plant Physiology, 166, 1263-1274.
http://dx.doi.org/10.1016/j.jplph.2008.12.016
[41] Camehl, I., Drzewiecki, C., Vadassery, J., Shahollari, B., Sherameti, I., Forzani, C., Munnik, T., Hirt, H. and Oelmüller, R. (2011) The OXI1 Kinase Pathway Mediates Piriformospora indica-Induced Growth Promotion in Arabidopsis. PLoS Pathogens, 7, e1002051.
http://dx.doi.org/10.1371/journal.ppat.1002051
[42] Bagheri, A.A., Saadatmand, S., Niknam, V., Nejadsatari, T. and Babaeizad, V. (2013) Effect of Endophytic Fungus, Piriformospora indica, on Growth and Activity of Antioxidant Enzymes of Rice (Oryza sativa L.) Under Salinity Stress. International Journal of Advanced Biological and Biomedical Research, 1, 1337-1350.
[43] Varma, A. Sree, K.S., Arora, M., Bajaj, R., Prasad, R. and Kharkwal, A.C. (2014) Functions of Novel Symbiotic Fungus Piriformospora indica. Proceedings of the Indian National Science Academy, 80, 429-441.
http://dx.doi.org/10.16943/ptinsa/2014/v80i2/55119
[44] Schulz, B., Wanke, U., Draeger, S. and Aust, H.J. (1993) Endophytes from Herbaceous Plants and Shrubs, Effectiveness of Surface Sterilization Methods. Mycological Research, 97, 1447-1450.
http://dx.doi.org/10.1016/S0953-7562(09)80215-3
[45] Saitoh, K., Togashi, K., Arie, T. and Teraoka, T. (2006) A Simple Method for a Mini-Preparation of Fungal DNA. Journal of General Plant Pathology, 72, 348-350.
http://dx.doi.org/10.1007/s10327-006-0300-1
[46] White, T.J., Burns, T., Lee, S. and Taylor, J. (1990) Amplification and Direct Sequencing of Fungal Ribosomal RNA Genes for Phylogenetics. In: Innis, M.A., Gelfand, D.H., Snisky, J.J. and White, T.J., Eds., PCR Protocols: A Guide to Methods and Applications, Academic Press, San Diego, 315-322.
http://dx.doi.org/10.1016/b978-0-12-372180-8.50042-1
[47] Zheng, Z., Schwartz, S., Wagner, L. and Miller, W. (2000) A Greedy Algorithm for Aligning DNA Sequences. Journal of Computational Biology, 7, 203-214.
http://dx.doi.org/10.1089/10665270050081478
[48] Morgulis, A., Coulouris, G., Raytselis, Y., Madden, T.L., Agarwala, R. and Schäffer, A.A. (2008) Database Indexing for Production MegaBLAST Searches. Bioinformatics, 24, 1757-1764.
http://dx.doi.org/10.1093/bioinformatics/btn322
[49] Mousa, W.K. and Raizada, M.N. (2013) The Diversity of Anti-Microbial Secondary Metabolites by Fungal Endophytes: An Interdisciplinary Perspective. Frontiers in Microbiology, 4, 65.
http://dx.doi.org/10.3389/fmicb.2013.00065
[50] Zhang, C., Ondeyka, J.G., Zink, D.L., Basilio, A., Vicente, F., Collado, J., Platas, G., Bills, G., Huber, J., Dorso, K., MOtyl, M., Byrne, K. and Singh, S.B. (2008) Isolation, Structure, and Antibacterial Activity of Phaeosphenone from a Phaeosphaeria sp. Discovered by Antisense Strategy. Journal of Natural Products, 71, 1304-1307.
http://dx.doi.org/10.1021/np8001833
[51] Giannetti, B.M., Steglich, W., Quack, W. and Oberwinkler, F. (1978) Antibiotics from Basidiomycetes, VI. Merulinic Acids A, B, and C, New Antibiotics from Merulius tremellosus and Phlebia radiate (Author’s Transl.). Zeitschrift für Naturforschung. Section C: Biosciences, 33, 807-816.
[52] Paul, N.C., Deng, J.X., Shin, K.S. and Yu, S.H. (2012) Molecular and Morphological Characterization of Endophytic Heterobasidion araucariae from Roots of Capsicum annuum L. in Korea. Mycobiology, 40, 85-90.
http://dx.doi.org/10.5941/MYCO.2012.40.2.85
[53] Sonnenbichler, J., Bliestle, I.M., Peipp, H. and Holdenrieder, O. (1989) Secondary Fungal Metabolites and Their Biological Activities, I. Isolation of Antibiotic Compounds from Cultures of Heterobasidion annosum Synthesized in the Presence of Antagonistic Fungi or Host Plant Cells. Biological Chemistry Hoppe-Seyler, 370, 1295-1304.
http://dx.doi.org/10.1515/bchm3.1989.370.2.1295
[54] Doshida, J., Hasegawa, H., Onuki, H. and Shimidzu, N. (1996) Exophilin A, a New Antibiotic from a Marine Microorganism Exophiala pisciphila. Journal of Antibiotics, 49, 1105-1109.
http://dx.doi.org/10.7164/antibiotics.49.1105
[55] Bischoff, K.M., Leathers, T.D., Price, N.P.J. and Manitchotpisit, P. (2015) Liamocin Oil from Aureobasidium pullalans Has Antibacterial Activity with Specificity for Species of Streptococcus. Journal of Antibiotics, 68, 642-645.
http://dx.doi.org/10.1038/ja.2015.39
[56] Chadhal, N., Mishra, M., Bajpal, K., Bajaj, R., Choudhary, D.K. and Varma, A. (2015) An Ecological Role of Fungal Endophytes to Ameliorate Plants Under Biotic Stress. Archives Microbiology, 197, 869-881.
http://dx.doi.org/10.1007/s00203-015-1130-3
[57] Kleczewski, N.M., Bauer, J.T., Bever, J.D., Clay, K. and Reynolds, H.L. (2012) A Survey of Endophytic Fungi of Switchgrass (Panicum virgatum) in the Midwest, and Their Putative Roles in Plant Growth. Fungal Ecology, 5, 521-529.
http://dx.doi.org/10.1016/j.funeco.2011.12.006
[58] Rai, M., Rathod, D., Agarkar, G., Dar, M., Brestic, M., Pastore, G.M. and Junior, M.R.M. (2014) Fungal Growth Promotor Endophytes: A Pragmatic Approach towards Sustainable Food and Agriculture. Symbiosis, 62, 63-79.
http://dx.doi.org/10.1007/s13199-014-0273-3
[59] Khan, S.A., Hamayun, M., Yoon, M., Kim, H.-Y., Suh, S.-Y., Hwang, S.-K., Kim, J.-M., Lee. I.-Y., Choo, Y.-S., Yoon, U.-H., Kong, W.-S., Lee, B.-M. and Kim, J.-G. (2008) Plant Growth Promotion and Penicillium citrinum. BMC Microbiology, 8, 231-240.
http://dx.doi.org/10.1186/1471-2180-8-231
[60] You, Y.H., Yoon, H., Kang, S.M., Shin, J.H., Choo, Y.S., Lee, I.J., Lee, J.M. and Kim, J.G. (2012) Fungal Diversity and Plant Growth Promotion of Endophytic Fungi from Six Halophytes in Suncheon Bay. Journal Microbiology Biotechnology, 22, 1549-1556.
http://dx.doi.org/10.4014/jmb.1205.05010
[61] Murphy, B.R., Doohan, F.M. and Hodkinson, T.R. (2015) Fungal Root Endophytes of a Wild Barley Species Increase Yield in a Nutrient-Stressed Barley Cultivar. Symbiosis, 65, 1-7.
http://dx.doi.org/10.1007/s13199-015-0314-6
[62] Murphy, B.R., Doohan, F.M. and Hodkinson, T.R. (2014) Persistent Fungal Root Endophytes Isolated from a Wild Barley Species Suppress Seed-Borne Infections in a Barley Cultivar. Biocontrol, 60, 281-292.
http://dx.doi.org/10.1007/s10526-014-9642-3
[63] Tunali, B., Shelby, R.A., Morgan-Jones, G. and Kodan, M. (2000). Endophytic Fungi and Ergot Alkaloids in Native Turkish Grasses. Phytoparasitica, 28, 375-377.
http://dx.doi.org/10.1007/BF02981832
[64] Yeh, Y.H. and Kirschner, R. (2014) Sarocladium spinificis, a New Endophyte Species from the Coastal Grass Spinifex littoreus in Taiwan. Botanical Studies, 55, 25.
http://dx.doi.org/10.1186/1999-3110-55-25
[65] Wicklow, D.T., Roth, S., Deyrup, S.T. and Gloer, J.B. (2005) A Protective Endophyte of Maize: Acremonium zeae Antibiotics Inhibitory to Aspergillus flavus and Fusarium verticillioides. Mycological Research, 109, 610-618.
http://dx.doi.org/10.1017/S0953756205002820
[66] Poling, S.M., Wicklow, D.T., Rogers, K.D. and Gloer, J.B. (2008) Acremonium zeae, a Protective Endophyte of Maize, Produces Dihydroresorcylide and 7-Hydroxydihydroresorcylides. Journal of Agricultural and Food Chemistry, 56, 3006-3009.
http://dx.doi.org/10.1021/jf073274f
[67] Muralidharan, K. and Rao, G.V. (1980) Outbreak of Sheath Rot on Rice. International Rice Research Newsletter, 5, 7.
[68] Schulz, B., Roemmert, A.K., Dammann, U., Aust, H.J. and Strack, D. (1999) The Endophyte-Host Interaction: A Balanced Antagonism? Mycological Research, 103, 1275-1383.
http://dx.doi.org/10.1017/S0953756299008540
[69] Moricca, S. and Ragazzi, A. (2008) Fungal Endophytes in Mediterranean Oak Forests: A Lesson from Discula quercina. Phytopathology, 98, 380-386.
http://dx.doi.org/10.1094/PHYTO-98-4-0380

Copyright © 2026 by authors and Scientific Research Publishing Inc.

Creative Commons License

This work and the related PDF file are licensed under a Creative Commons Attribution 4.0 International License.