Could There Be a Common Property Method for Expressions of Both These Constant Numbers Such as Faraday Constant Number and Einstein Constant Number with Nucleotide Bases? ()
1. Introduction
One of the observable macro or micro universal movements of cyclical and elliptical shapes of spirals can be an invoking starting point of view to the Quantum Perspective Model. Some of these elliptical movements can be regarded as mostly golden ratio spirali rates. Besides, the other particular spiral may be considered by the Theodorus spiral [1], including many squares of basic decimal numbers such as √2 [2], √3 [3], √5 [4], √7 [5], √10 [6], … and so on etc. That’s to say, the particular Theodorus spiral consists of the square number of decimal numbers. If in the case of expressing this square root number of Theodorus spiral numbers as nucleotide bases, it can be considered by the dual attribute of quantum-entangled sub-particles similar to dual nucleotide bases. Some of them are pretended to be√2 equals ‘TGA’, √3 equals ‘TAG’ and √5 and √7 equals ‘ATT ‘nucleotide bases particularly and √10 almost equals to twice ‘AAG’ or ‘AG’ and lastly the square of the imaginary number(i2) almost equals to specific twice ‘AG’ nucleotide bases or ‘AAG’ as similar as to the expression of both Einstein (‘AG’ nucleotide bases)and Faraday Constant number with again ‘AG’ nucleotide bases (Please, see Table 1). Similarly, as pertaining to the quantum superposition of quantum-entangled nucleotide bases, this dual (2) times occurring number occurrence can be likely seen as the quantum duality principle of quantum superposition theoretically.
Table 1. The expression of some irrational numbers and some constant numbers as genetic codes.
Number/constant |
The expression as nucleotide bases |
√2 |
GGATGTCTATTGAGTGACAA |
√3 |
GGATGACTACGGGTTTAGAAA |
√5 |
ATTTATTCAATACATAACCCCATTGA |
√7 |
GATTUAAGUTAATATTAUTAGTTTGATT |
√10 |
ATAAGTCATAAGTGTAATTAGTTTAAAACTTG |
i² |
AATGGGCCCUUGAAGAACUUUAAGTTTGGG |
Einstein Constant |
‘CTATAGAA’ or ‘CTHTHXHH’ |
Faraday Constant |
‘AG’ or ‘UG’ |
On the other hand, while considering the golden spiral shape, the golden ratio [7], rate can be considered a golden-rated spiral such as at a + b/a = a/b. The translation movement [8], of the Fibonacci sequence, for example, while considering the golden ratio (a/b) 225.5/137.5 = 1.6 and a + b/a = 360/225.5a + b/a = 360/225.5 = 1.6 during one cyclic movement pattern as regards to one golden ratio rated spiral movement. After reevaluating the golden ratio numbers with three (3) unchanged decimal numbers such as 1.618, with six-one-eight (6-1-8) totally (6 + 1 + 8 = 15) with fifteen (15) each total sums occur (for instance, almost both of them having equals to the same decimal after the comma; each one: 65/34 = 89/55 = 1.618). Namely, 1.618 with generally triplet (3) three decimal numbers such as 6-1-8. While considering Euler’s numbers, the total sum equals fifteen (15) decimal digits. On the other hand, while researching “15—fifteen” at Euler numbers [9], expression as a nucleotide base again with mostly “fifteen (15)” each decimal numbers calculated and grouped such as the expression of Euler numbers [9], decimals after the comma This triplet (3) three unchanged golden ratio number “618” also appears with triplets at the fine structure constant numbers (1/137) [10], detected such as (1/137: 1-3-7) with three main decimal numbers. Afterwards, while in case of the total sums of 1-3-7 numbers even equal to 1 + 3 + 7 = 11 eleven numbers. Namely, while considering 137 as the fine structure constant number with squares of both eleven and two’s, it can be summarized as 137 = 11 × 11 + 2 × 2 × 2 × 2 = 112 + 24 = 137 equations. Besides, in case of researching the Leibniz Pi function [11], again with dual (2), two triplet-three ratios can be detected. (1/3 regarded as the ratios of triplet (3) codons and ‘2’ number regarded as quantum superposition of dual quantum entangled particles). On the other hand, golden ratio numbers can be stemmed from Pascal’s binomial triangle [10], and the Fibonacci sequence. Similarly, Lah’s triangle, [12], while the total sum calculation of next sequence rows, mostly occurred at “two (2) times” more than from previous total sums of row numbers. Moreover, while remembering that the universal genetic code table includes triplet-three (3) nucleotide-based codons or amino acids. In sum, no matter what level of macro or micro sample research or observance, mostly not only the main genetic codes of subatomic cells consist of triplet (3)-three codons but also at much larger elliptical translational movement of cycling were also at the specific triplet unchanged numbers of golden ratio spiralled such as 55/34 = 1.618 with three unchanged decimal digits of “6-1-8.” Before the article, Einstein constant numbers [13], expression as nucleotide bases such as either “CTATAGAA” or “CTHTHXHH” was researched. Similarly, not only were some irrational numbers such as the square root of numbers two (2) [2], three (3) [3],, five (5) [4], seven (7) [5],, and ten (10) [6],, Euler and Pi numbers researched, but also some universal constant numbers (such as Planck constant [14], gravitation constant numbers [13], Boltzmann and Bohr Magneton Constants [15], … etc.) were researched too. When investigating Faraday constant numbers [16], expressions such as “AG or UG” nucleotide bases are used. Similarly, “AG” is included not only in the expression of the Faraday constant number, such as AG, but also in the expression “CTATAGAA”, which is one of the expressions of the Einstein constant number. Thus, some of the “AG” nucleotide have been investigated, but also NCBI BLAST [17] has been investigated. The search results are listed in this article (Please, see Figures 1-9).
2. Methods
Regarding the Quantum Perspective Model, T. ÖLMEZ expressed some irrational numbers as well as some irrational numbers as chemical formulas of nucleotide bases. Some of these irrational numbers are Pi, Euler, the golden ratio numbers and the square root of two [2], the square root of three [3], the square root of five [4], the square root of seven [5], the square root of ten [6]. In these articles, it was aimed to investigate the relationship between numbers and nucleotide bases. In summary, the purpose of these past research papers was to investigate the relationships between atomic weights, radix systems, and chemical formulas of nucleotide bases. Also, in this article, this relationships between all this previous research articles were researched by this Quantum Perspective Model [16] again with regards to some universal constant numbers.
The NCBI blast search results for ten times ‘AG’ nucleotide bases.
Figure 1. The ncbi blast search database.
Figure 2. The search result of tree for ten times ‘AG’ nucleotide bases.
Figure 3. The NCBI blast search for tardigrades.
Figure 4. The NCBI blast search results for tardigrades.
Figure 5. The sum of ten times ‘AG’ nucleotide bases.
Figure 6. The similiar ncbi blast search for danio rerio and homo sapiens.
Figure 7. The ncbi blast search for ten times ‘AG’ nucleotide bases for humans.
Figure 8. The NCBI blast search for ten times ‘AG’ nucleotide bases for humans.
Figure 9. The NCBI blast search for ten times ‘AG’ nucleotide bases for danio rerio.
E = m * c2 = h * f; The Planck Constant Number [14], (h): Adenine(A); the mass of electron (m): Uracil [18], the square of velocity of light(c2) [19], equals to AUC-ADENİNE-URACIL-CYSTOSINE. Then the frequency of electron(f) almost equals to f = m * c2/ * h. So, f = Uracil * AUC (AdenineUracilCystosine)/Adenine. Therefore after dividing this equation to Adenine, the rest of this Formula can be sorted just like this here: UUC (Uracil Uracil Cystosine). Even, after researching the base pair of UUC (Uracil Uracil Cystosine); the result can be shown just like this: Adenine Adenine Guanine (AAG).
If considering into the first result of this equation ‘UUC-Uracil-Uracil-Cystosine’ may shed lights on the probable the smallest quanta of mass such as’ C-Cystosine’ theoretically. Even, after researching previous the calculation of both Faraday Constant Number [16], such as ‘AG’ or ‘UG’. Letalone, even the expression of Einstein constant number with nucleotide bases such as ‘CTATAGAA’ OR ‘CTHTHXHH’ [13], theoretically. In sum, the main common feature of all this cited variables may be paved the milestone of ‘ADENINE AND GUANINE (A-G) nucleotide bases for Quantum Entanglement predictably.
Please, see Table 2 for the representation of nucleotide bases (A, T, C, G, U, H and X) in chemical atoms.
3. Results
Leibniz [11] Formula of Pi [20] Cycle; Pi/4 can include many decimal numbers that summed by the ‘quarter (4)’ of the Pi number [20]. Similarly, the fine structure constant number [10], (1/137) also includes the square of both eleven (11)
Table 2. The representation of nucleotide bases [A, T, C, G, U and HYPOXANTHINE-H- in XANTHINE-X chemical atoms (Updated version)].
Atoms/nucleotide bases |
C = 6 |
H = 1 |
O = 8 |
N = 7 |
SUM |
Adenine: C5H5N5 |
5 |
5 |
- |
5 |
70 |
Hypoxanthine: C5H4N4O1 |
5 |
4 |
1 |
4 |
70 |
Cytosine: C4H5N3O1 |
4 |
5 |
1 |
3 |
58 |
Guanine: C5H5N5O1 |
5 |
5 |
1 |
5 |
78 |
Xanthine: C5H4N4O2 |
5 |
4 |
2 |
4 |
78 |
Thymine: C5H6N2O2 |
5 |
6 |
2 |
2 |
66 |
Uracil: C5H4N2O2 |
5 |
4 |
2 |
2 |
64 |
and four (4) numbers. For instance, 137 = 112 + 42 = 137. Similarly, sub-atomic energy levels [21] were listed with four (4) basic energy stepssuch as 1) ATP, 2) ADP, 3) AMP, 4) cAMP. Besides, Homo sapiens have 42 unchanged gene sequences just like ADP (42) [22] with 42 atoms. Previously, while calculating the value of the expansion of the universe (Photon light universe = ATC + Expansion of Universe) equals to Dark Matter Universe. For example, [ATC (194) + Exp. of Univ (18) = 212 = UAG] [10]. Interestingly, the expression of the dark-mattered universe was even together with “UAG” (adenine-guanine nucleotide bases) such as “UAG-Uracil-Adenine-Guanine. “Even while taking the total sum average of subatomic energy levels such as [ATP (47), ADP (42), AMP (37), and cAMP (34)] equals to 160 surprisingly. While calculating the hundred percentage of this number (160), for example (160/100 = 1.6) even consisting of unchanged golden ratio numbers such as 1.618 and 1.6 specifically. Furthermore, most Homo sapiens’ unchanged nucleotide base sequence even equals ADP (42) with the same total 42-forty two numbers. One of the startlingly more common ratios of this calculation mostly consists of the magic number of seven (1/137 = 0.007, 1/37 = 0.027, and so on). In sum, while calculating the fine structure constant number (137), 137 equals both dual powers of the number eleven (11) and four (4). Let alone, while converting the number eleven (11) to any other number base after five-number base and the other upper five-number base equals the number four (4), too. For example, (11)3 = (4)5. Again, four times two (24 = 16) sixteen-digit numbers can be viewed in TIFF format images. In sum, it doesn’t matter from which perspective the researcher observes; mostly, adenine-guanine nucleotide bases paved the cornerstone of quantum entanglement [23], either at the Einstein constant (CTATAGAA) [13] or at the Faraday constant number [16], such as “AG or UG” nucleotide bases. Another triplet (three) digit cycling systems were detected in both the genetic universal code table and golden ratio numbers unchanged with three decimal digits (1.618; 55/34 = 1.618). Let alone, the start and stop codons of the universal genetic code table consist of specific “AG-adenine and guanine” nucleotide bases particularly (remember start codon AUG, stop codons with again three codons UAG, UAA, and UGA). Lastly, both start and stop codons including specific adenine and guanine nucleotide bases, generally in sum, the dark-mattered universe can even be evoked by UAG (Uracil-Adenine-Guanine) codon with the stop codon UAG = 212. For example, ATC = 194 (Photon Light Universe) added with the Expansion of the Universe (18) equals 212 (“Dark Mattered Universe,” too).
4. Discussion
There may be a “DUAL Universe”: One of them is a Clockwise Spiral Shaped ‘Light ENERGY/Matter Originated Universe’; The other could be the Counterclockwise oriented Reverse Spiral “Dark Energy/Matter-induced Universe”; Namely: As an example of “Infinite COINSCIENCE”—[compared to Computer SOFTWARE TRIPLET-Ternary-Number SIMULATION with CPUs]~ (Again, “TRIPLET” contains imaginary numbers (−1; 0; 1)] [24]. In short, the Universe codes arising from the existence of DUAL REAL kernel 3-life can even be ‘DUAL TWIN’, just like the origin of the INFINITE dimension of the fine structure constant number [10]. (Remember, it may even be the origin of the FSC number—“Uracil:64:8×8”; Again, the only difference in the Nucleotide bases of the Double helix genetic codes of the cells, including TWIN (DNA/RNA), is this: (As for DNA with ‘Thymine:66’ and RNA with Uracil:64); This is with (U-T) in case of substraction(66-64:2), nucleotide bases can give rise to a “Length with TWO-2-Value” at quantum level; Let alone, between these TWIN(2) base pairs, the difference in measured atomic masses [25], and the numerical Value ‘Two(2)’ are also very- (“U-T Nucleotide bases”) small difference in atomic masses is probably the smallest quanta length in micro-level systems of genetic codes. In conclusion, regarding the “Quantum Perspective Model” [26], the smallest well-known storage of permament memory of DNA into Micro-level systems is only the atomic mass of ‘URACIL’. Not only does it come from ‘URACIL: 64’, but the number ‘64’ can even apply to the sum of “64” kind of variety the TRIPLE codons of the Universal Genetic Code Table (Remember, There are 64 various different genetic codes too). In short, maybe; As for computable finite research methodologies, Today’s Scientific “Unit of Measurement” is likely to be based on “Triplet-3-ternary-SOFTWARE [13], Computer Programmed ‘SIMULATION’/’ILLUSTRATION METAVERSE’ as a variable on the motherboard of the Three-dimensional ‘Curved’ Space-Time Universe;’ The smallest finite of the measurable is almost certainly and with the previously calculated powers of THREE-3- and “TWO long-numbered-2 numbers (2 * 3 × 2 * 3 = 8 × 8 = 64); Namely, ‘64’ could be the spark/beginning of an ‘INFINITE EXPLOSION of BLASTS’ (Remember, previous and subsequent historical predictions “The Beginning of Existence Phenomenon” could also be described as a ‘BIG BANG’) [27], Theory. Also, it probably stems from infinite recursive cyclic systems over and over again. Specifically, ‘Approximately calculated pi’ ‘Circularization of NUMBERS’ (22/7:3.142857...142857 INFINITE). It can be speculated that ‘142857’ is caused by recursive cyclic repeative Pi [28], numbers theoretically. (Specifically, it may be possible that there is an estimate of resulting from ‘Circularization of almost PI NUMBERS’) (22/7:3.142857...142857), with INFINITE ‘142857’ continuing series of numbers and the “Butterfly Effect” to other numbers some special irrational numbers according to infinite fractions/decimals/ratios like a domino affected “Euler numbers [9], like the golden ratio number [7], cycle/Ellyptic” Translational Motions [8], -Momentums (These can even be Matter-Motion Paradigms) infinite fine structure constant numbers [10] are derived from “137” [(Remember, ‘137:11 × 11 + 4 × 4:112 + 42=137)]; So maybe even the ‘existence’ of FIBONACCI SERIES Numbers is ‘11 and 4’ can refer to this TWIN-BINARY numbers [(Remember, powers of ‘ELEVEN (11)]’ can lead to multi-dimensional total numerical numbers. So what might be the “definition” of “TIME” itself and its variables? It can really shed light on future discoveries and innovations, it is very likely to be interested in these infinite constant numbers such as Fine structure constant numbers (1/137) (Please, re-imagine/rethink for a moment; infinite permament taking pictures of Illustrated movies of the life of “everything” SCENES (1; 3; 7 color frequency spectrum ranged; -1-ONE-White; -3-THREE-RedGreenBlue Main colorful; -7-SEVEN Rainbow ed Colorful ) -’may even be a Cascading? TRIAD with THREE-DIVISION lifespans. Then Please Note that the Still Use of “FINITE SCIENTIFIC UNITS OF MEASUREMENT” Can Be Considered a Non-Probability Illusion, No Matter What, No Matter What, Even/-Wait and See-That is, the fact that “the life of light photons and subatomic particles” act either as particles or wavelengths, and their experiences to date, and what are called “finite units of measurement” invite us to think about the idea of “finite units of measurement”-in particular, about “units”. ‘Re-evaluate the journey of light photons as a vast and infinite observation of the departures/steps of photon lights, just as in the THREE Forms of the ‘appearance of light photons’ with the naked eye—VISIBLE—Observation of the “color spectrum of wave light spectra” (1; 3; 7) (Please, see Table 3). Variable times a day “infinite triplet number-based. -Perhaps pi cyclic (‘Forward and Back’ cyclic functionally with infinite “CAMERA” s ‘fps’)—SOFTWARE. The program can periodically save ‘TIFF’ format like time limited life movie “FIGURES” Calculation—EXCLUSIONS—instantly looks very close—”Interface”—‘Infinite saving of CPU’ Four Variables ‘TIME’ periodic smallest interval time—quanta/smallest VARIABLES Capture mostly numbered “Four-4” Picture Forms of Life Films Periodic ‘Pictures’ Film It’s about. VIDEOS-FPS-Front Page Second data-Periodic/Equal cycle/Elliptical Motion Second Record. Aside from this recording ‘RAM/ROM’ and Moreover, ‘Datums’, when recording instantaneous memories of Data, it can also be referred to as ‘Cloudy-Cache’ memory, related to ‘Pascal’s Binomial Triangle’, but also Sun-flowered, much more Compressed Data Storage as to permutation. [Remember, this is also “TRIPLE” (pi [28], phi [7], Euler’s [29] [30])]. Even in the range of TRIPLE numbers (Mostly Unchanged Phi number decimals/variables with TRIPLET DIGITS:1.618 [31], mathematical triplet integer decimal numbers); (1.618; 6-1-8). Even this may be 3-Variabled Ternary number-based SOFTWARE Program, predictably)]—similar to the “TRANSLATION MOVEMENTS” caused by the golden ratio, the golden ratio unchanged trio ‘618’ [31] caused by this translational movement can also be observed at subatomic micro levels with numbers in cis regulatory elements (TATA /CAAT/GC Boxes) as regarding the true origin of the core life codes in this three-dimensional planetary motherboard Universe. In brief, could even the Cosmos itself be the Unitary of the DUAL UNIVERSE (Dark/light) as an INFINITE SOLELY ONE (1) UNITED COINSCIENCE?
Table 3. The photon lights probable TRIPLET STAGES at the fine structure constant number F.S.C. (1/137).
Photon Lights Probable Triplet (1-3-7) Stages at F.S.C. (1/137) |
Specialities |
Dual One’s (1) |
Triplet (3) |
Seven (7) |
Colors |
Black/White |
Red-Green-Blue |
7-Rainbow |
Variables |
Binary (One; Zero) |
Imaginary (−1; 0; 1) |
2, 3, 4, 5, 6, 8, 9 |
Point Observance |
Dual Pointed Line |
Triangle Prism |
Dual Twined Prism |
System |
Pascal Binom Triangle |
Lah’s Number Triangle |
Acid-Base(Ph) Ratio Scale |
Energy Levels |
Nuclear (Weak/Strong) |
Chemical; Gravity; Magnetic Inner |
Outer Energy Conservation Forms |
Gene Expression |
Purine (A; G) N. Bases |
Pyrimidine(C; T; U) |
A; G; C; T; U; X and H |
Chemical Bonds |
Atp (47) and Po4 (47) |
Adp (42); Amp (37); Camp (34) |
Adenine (A) Forms |
Absorption |
Lower |
Higher |
Visible Color Spectrum |
Classification |
Dual (Fe)/Male |
Triplet Codons/Amino Acids |
Logaritmic Ph Scale |
Formula |
Adenine/Hypoxanthine |
Auc (For Pi;Uta~Uaa Start Codon) |
Ccaauuu |
Atoms |
Carbon and Hydrogen |
Carbon, Hydrogen, Nitrogen |
C; H; O; N; P; Iron and Magnesium |
Infinite Cycle |
Entrophy; Entalphy |
1/14:0.07142857... and 1/13:0.076923… |
1/7:0.142857… |
Memory |
Read Only Memory (Rom) |
Cache; Imaginary Data |
Random Access Memory (Ram) |
Locality |
Singularity (Aug Start) |
Duality (Wave and Particle States) |
Seven (7) Cis Regulatory Elements |
Situation |
Pineal Glande (Bios) |
Brain; Spirit; Hearth |
Five Senses + Spirit + Coinscience |
After searching ‘AG’ nucleotide bases ten times for NCBI Blast search database, not only the consequence of this research listed by one of the excellent homo sapiens similar genetic sample of Danio Rerio, but also the other one of the significant genetic sample organism of tardigrade [32] genes were found. (For more information, please see the Figures 1-9).
The NCBI (National Biotechnology Information Center) summary and genetic sequences of some irrational numbers √2 [2], √3 [3], √5 [4], √7 [5], √10 [6], and some constant numbers (Pi [20], Euler’s [29], Golden Ratio numbers [31]) were also commonly used mostly with the Einstein constant number [13] as well as Danio Rerio (Zebrafish) NCBI RESULTS.
5. Conclusions
After calculating both the expansions of the universe, gravitational number, and Einstein constant number, according to the quantum perspective model, one of the common features of both the Einstein constant number and Faraday constant number may shed light on ‘AG-adenine and guanine’ nucleotide bases specifically. At first, the Einstein constant number can be expressed either as ‘CTATAGAA of CTHTHXHH’ previously. Secondly, the Faraday constant number can even be expressed as either “AG or UG” nucleotide bases. Thirdly, at the confirmation of the fine structure constant number article (please see reference FSC) [10], the conclusion of this research may take a breakthrough novel expression of the dark universe such as “ỦAG = 212” (please remember, photon light universe ATC (194) + expansion of universe (18) = dark universe (212)). Fourthly, while taking into consideration the expression of the Faraday constant [16], it may be strictly or keenly related to silkworms as regards to NCBI BLAST results. Even the evolution of wormhole to butterfly may shed light on the transmission between photon light universe and dark universe via black holes thanks to quantum entanglement of nucleotide bases such as ‘adenine and guanine’ specifically. Fifthly, one of the excellent genetic samples of tardigrades’ genes of “AG with ten times” may even evoke resistance to radioactivity genes. Sixthly, while researching the stemming of both the golden ratio and Fibonacci sequence at Pascal’s binomial triangle, it may pave the cornerstone to Lah’s number triangle [33], as pertaining to the dark universe hypothetically. This is because Pascal’s binomial triangle is constituted by the square and any other powers of both the specific number of eleven (11) and two (2). On the other hand, some of Lah’s number’s rows equal previous sum total numbers, mostly. Seventhly: After that, while researching ‘AG’ nucleotide bases ten times at NCBI BLAST search results, some of the significant particular genes of tardigrades were listed one by one (Please see Figures 1-9). Eighthly: In this article, the calculation of electron frequency summed by ‘UUC’ nucleotide bases. Namely, the pairs of ‘UUC’ equal to “AAG” again with listed “A-G” nucleotide bases, theoretically. Ninthly: Thanks to the calculation method of electron frequency, either start and stop codons [34] can be seen in this calculation of electron frequency too. Namely, lastly, according to this hypothetical strategy to shed light on “quantum entangled dual adenine-A and guanine-G” nucleotide base particle paved the way to quantum teleportation predictably. Because not only approximately infinite summed ratio of Pi can be summarized as forever “UTA’s [28], but also dual quantum entangled gravitons can be summarized by either “CTATAGAA” or “CTHTHXHH” [13].
In sum, thanks to the quantum perspective model, either graviton or gravitono can be researched by this perspective to unravel the secret mysteries of quantum teleportation hypothetically. Because tardigrades [32], can survive in harsh circumstances, even in nuclear leaked or radioactive circumstances altogether, can it be possible to combine all similar genetically coded samples such as tardigrades, bony fishes, and Bombyx mori altogether at once in future novel research experiments for quantum teleportation and quantum entanglement? Or can it be possible to invent a silk cocoon membrane [16], with regards to a Faraday cage [13], to make quantum entangled particles of both “adenine and guanine” (AG) through dark wormholes? As expected, it is likely to evolve from a silk wormhole to a Bombyx mori butterfly [16], or the black/dark matter vortex and the neural cortex systems of the brain’s memory membrane may be related to each other in future new inventory experiments. Who knows? As the numbers of photon light velocity of light numbers totally summed by ‘55 (fifty-five)’ likely to golden ratio numbers also consisting of the ‘55’ number. (Remember, golden ratio 55/34 = 1.618, 618 with unchanged numbers C = 2 + 9 + 9 + 7 + 9 + 2 + 4 + 5 + 8 = 55 C = 299792458 m/s or chemical molecular structure resemblance of either chlorophyll or hemoglobin with the exception of its center either from iron (blood) or magnesium (light)? (Please, see Figure 10).
![]()
Figure 10. The chemical molecular structure of Chlorophyll (Mg—magnesium) and Hemoglobin (Fe—Iron).
Acknowledgements
The author would like to thank this TRIPLET (3). One of them is only my son Kadir ÖLMEZ and the second one is to our almighty whole mother’s for their infinite loves to Universe, especially to my best mother Hafize ÖLMEZ. Finally, to my best darling son’s mother Esra YILMAZ.
Conflicts of Interest
The author declares no conflicts of interest.