Advances in Bioscience and Biotechnology, 2012, 3, 609-619 ABB
http://dx.doi.org/10.4236/abb.2012.35079 Published Online September 2012 (http://www.SciRP.org/journal/abb/)
PUB16 gene expression under abiotic stress and their
putative role as an ARM repeat protein in Arabidopsis
thaliana self-pollination pathway
María Gabriela Acosta1,2, Miguel Ángel Ahumada2,3, Sergio Luis Lassaga2,3, Víctor Hugo Casco1,3
1Microscopy Laboratory Applied to Cell and Molecular Studies, Engineering School, National University of Entre Rios, Oro Verde,
Argentina
2Biotechnology Laboratory, Genetics and Plant Breeding Department, INTA-Estación Experimental Agropecuaria Paraná, Oro Verde,
Argentina
3Agricultural Sciences School, National University of Entre Rios, Oro Verde, Argentina
Received 13 June 2012; revised 20 July 2012; accepted 14 August 2012
ABSTRACT
The armadillo repeat super-family proteins (ARM
repeat super-family proteins) possess tandem arma-
dillo repeats and have been postulated to play differ-
ent roles in plant development, morphogenesis, de-
fense, cell death, and signal transduction through
hormone signalling. In The Arabidopsis Information
Resource (TAIR), we found 113 loci closely related to
ARM repeat family proteins. This extensive group of
proteins was studied in flowers tissues by western blot
using antibodies directed against the most conserved
region of the ARM repeat family proteins. The amino
acid residues sequences from TAIR were aligned and
the resulting phylogenetic tree allows us to inferring
their evolutionary relationships. The main finding
was the high similarity between the gene product of
PUB16 (At5g01830, A. thaliana) and ARC1 (Brassica
napus). In order to search a possible role for PUB16
we carried out stress bioassays using hormonal and
saline approaches. Gene expression using RT-PCR
showed that some of the ARM repeat super-family
proteins are expressed both under salt or hormonal
stress conditions. Particularly these studies allowed to
detect and semi-quantify PUB16 gene expression in
normal or stress growth conditions. In this approach
it was revealed that, only in presence of GA, the ex-
pression of mRNA-PUB16 became evident. To mor-
phologically verify the increasing number of germi-
nated pollen grain in gibberellins treated flowers, we
used epi-fluorescence microscopy assay. These results
suggest that PUB16 may participate in GA signaling
pathway favoring self-pollination.
Keywords: Self-Pollination; ARM Repeat; Gibberellins
1. INTRODUCTION
ARM repeat family proteins are present in animal and
plants and they are known to play key roles in several
cellular processes including, signal transduction, cy-
toskeletal regulation, nuclear import, transcriptional regu-
lation, and ubiquitination [1]. This kind of proteins are
found in the proteomes of almost all eukaryotic organ-
isms and possesses ARM repeat domains, each one are
constituted by multiple of 42 amino acid residues. The
ARM domain is a highly conserved right handed super
helix involved in protein-protein interactions. ARM re-
peat domains in plants have evolved as unique domain
organizations, such as the U-box and ARM domain com-
bination, with specialized functions. The plant-specific
U-box/ARM domain proteins are the largest family of
ARM repeat proteins in all the genomes surveyed and
recent data have implicated these proteins as E3 ubiq-
uitin ligases [2]. While functions have not been assigned
for most of the plant ARM repeat proteins, recent studies
have suggested their importance in multiple processes
such as self-incompatibility (SI), hormone signaling and
disease resistance [3]. U-box proteins are also involved
in very important plant specific pathways [4] such as SI,
Pseudo-Self-Compatibility (P-SC) [5]; and abiotic stress
responses [6].
Pollination is a crucial step in the life cycle of Angio-
sperms, the most important cell-cell interaction in flow-
ering plants and this is the mating system adopted by
plants species where the pistil is fully developed and
composed of stigma, style and ovary [7]. This process is
influenced by several factors: stigmas types (i.e. dry
stigma or wet stigma) and stigma receptivity (defined as
ability to “capture” pollen by adhesion). The appropriate
stage of stigma development is crucial for receptivity: on
the mature stigma, mature pollen can adhere, hydrate and

M. G. Acosta et al. / Advances in Bioscience and Biotechnology 3 (2012) 609-619 610
germinate. An efficient pollination between pollen grain
and pistil is dependent on the ability of the pollen grain
to adhere effectively to stigmatic surface [8].
Pollination can be classified in two categories, self-
pollination (or autogamy) and cross-pollination (or al-
logamy). In nature there is always support for cross-pol-
lination because this process ensures the species mainte-
nance and contributes to increase the genetic variability
in order to provide to species more ability to adapt to
new environments [9,10]. To avoid inbreeding and pro-
mote out-crossing, many plants have adopted SI systems
[11]. In SI plants, pollen will not develop on a stigma
that expresses the same S (sterility) alleles as the pollen
parent [12].
Members of the Brassicaceae have a dry stigma and
one of the interesting features of this trait is the early se-
lectivity of pollen capture following pollination [13,14].
Once pollen grains come into contact with stigmatic pa-
pillae, only pollen grains recognized as compatible are
accepted, thus allowing plants to ignore foreign pollen.
These compatible interactions appear to be specific to
species within the family, but clearly can occur beyond
the species level [15]. For example, success pollinations,
as measured by pollen tube penetration into the stigma,
have been observed in interspecific and intergeneric
crosses in the Brassicaceae [16-18]. Arabidopsis belongs
to the Brassicaceae family and therefore has dry stigma
with many large unicellular papillae that interact directly
with the pollen [19]. The sequential events from pollen
adhesion to the path of pollen tube growth through the
pistil to the ovule for fertilization have been carefully
documented at ultrastructural level in Brassica spp. and
Arabidopsis thaliana [20-25]. The best characterized pol-
len-pistil interaction on dry stigma is SI response in Bras-
sica [13]. Breakdown of the pollination barrier SI in older
flowers, a phenomenon known as P-SC or transient SI,
has been described as an advantageous reproductive as-
surance strategy that allows self-pollination when oppor-
tunities for out-crossing have been exhausted [5,26]. The
SI phenomenon seems to be controlled sporophytically by
a single S locus with multiple alleles or variants and a set
of complex dominance relationship between alleles [27-
29]. Its components constitute the male determinant SCR
[30-34], the female determinant SLG secreted by the
stigma into the cell wall, SRK located in the stigmatic
plasma membrane and its ARC1target, also produced in
the stigma [19]. ARC1 is a protein required in the Bras-
sica pistil for rejection of pollen self-incompatible; it
function downstream of the SRK. ARC1 promotes the
ubiquitination and proteosomal degradation of compati-
bility factors in the pistil, which in turn leads to pollen
rejection [35]. ARC1, a positive regulator of Brassica SI
protein, was originally identified in a screen for proteins
interacting with the active SRK kinase domain and binds
to the phosphorylated kinase domain through its ARM
domain [36]. The active SRK kinase domain can also
cause the re-localization of ARC1 from the cytosol to the
ER-associated proteasomes when it is transiently ex-
pressed in tobacco BY-2 cells [35]. A second kinase in
Brassica SI signalling, the cytoplasmic Ser/Thr protein
kinase, designated as M-Locus Protein Kinase (MLPK),
also causes the re-localization of ARC1 to the perinuclear
region and quite efficiently phosphorylates ARC1 in vitro,
suggesting that MLPK may co-regulate ARC1 in con-
junction with SRK [37-40].
The proposed model predicts seven ARM domains in
ARC1 amino acid residue sequence C-terminal end [35].
ARM repeat super-family proteins shared a conserved
three-dimensional structure: tandem ARM repeat form a
right-handed super-helix of alpha-helices [1] and they
mediate different cellular processes including signal
transduction, cytoskeleton regulation, nuclear import,
transcriptional regulation and ubiquitination [2]. There
are hundreds of eukaryotic proteins with theses tandem
structural units. The first member of the gene family to
be characterized in detail was the mutant phenotype
Drosophila segment polarity gene armadillo [41]. In
mammals, their homologue β-catenin, it is known to
function in several mechanisms during development,
regulating gene expression and cell-cell adhesion [1].
The existence of ARM repeat family proteins in plants
may possess very different functions in signal transduc-
tion and development, including morphogenesis, defense
and cell death, and allow us to predict a mechanism that
has been conserved throughout eukaryotic evolution. A
large subset of Arabidopsis proteins similar to β-catenin
(i.e. ARABIDILLO-1 and -2) contain ARM domain;
they are part of the PUB family [1,2,42]. In this work we
analyze, compare and predict evolutionary relationship
between ARM repeat super-family proteins, present in
the Arabidopsis genome [43]. The objective of the pre-
sent work was to study the gene expression of PUB16
under abiotic stress and their possible role as an ARM
repeat protein in self-pollination pathway.
2. MATERIAL AND METHODS
2.1. Plant Material
2.1.1. Plant Growth Condition
Arabidopsis thaliana (L.) wild-type ecotype Columbia-0
[Col-0] plants were grown on a mix of sterile soil
(autoclaved before use), vermiculite-perlite and humus.
Growth chamber was adjusted to 23˚C and 70% humidity
with a 16/8 h light/dark photoperiod under fluorescent
illumination supplemented by incandescent light yielding
an intensity of 100 - 150 mE/m2·s. The modified Hoag-
land solution used to irrigate the plants was done
according [44]: (NO3)2Ca·4H2O 0.55 mM; NO3K 0.52

M. G. Acosta et al. / Advances in Bioscience and Biotechnology 3 (2012) 609-619 611
mM; SO4Mg·7H2O 0.22 mM; PO4H2K 0.11 mM; BO3H3
0.046 µM; SO4Zn·7H2O 0.00076 µM; SO4Cu·5H2O
0.00031 µM; Cl2Mn·4H 2O 0.0078 µM; MoO4Na2·2H2O
0.00045 µM; SO4Fe·7H2O 9 mM; NaOH 25 mM. The
irrigation frequency was two times weekly with 200 ml of
modified Hoagland solution per plate (15 cm × 55 cm)
containing 64 pots (one plant/pot).
2.1.2. S tr e ss Induction
For the ABA treatments, (100 µM and 200 µM during 2,
4, 8, 11 or 24 hours) 50 open flowers randomly selected
from different plants (stage 13 according to [45]), were
placed on a Styrofoam disc with small holes containing
the ABA solutions. All the setup was placed into a Petri
disc. For both ABA concentrations, and the five times
assayed, the experiment was replicated twice. The ABA
treated flowers were frozen and stored in liquid N2 until
use for RNA and proteins extraction. As experimental
control, ABA was replaced by vehicle (bdH2O).
The GA treatment was done in flowering plants (stage
13 according to [45]) using triple spray every 2 days with
100 µM and 1000 µM of GA3 in controlled chamber
growth conditions. The experiment was replicated twice.
From each replicate 50 stressed flowers were randomly
collected, frozen and stored in liquid N2 until use for
RNA and proteins extraction. As experimental control,
GA was replaced by vehicle (bdH2O).
Salt stresses were performed using 50 mM and 100
mM NaCl for 10 days from rosette of 8 leaves according
to [46]. Subsequently, we return to the Hoagland solution
irrigation. The experiment was replicated twice. From
each replicate, 50 stressed flowers were randomly col-
lected, frozen and stored in liquid N2 until use for RNA
and proteins extraction. As experimental control, NaCl
was replaced by Hoagland solution.
2.2. Identification of ARM Repeats
Super-Family Proteins in the
Arabidopsis Genome
2.2.1. Se qu ence Anal y s i s
Sequences data were obtained from TAIR (The Arabi-
dopsis Information Research: http://www.arabidopsis.org/)
and BLAST (http://blast.ncbi.nlm.nih.gov/) searches were
performed on NCBI (National Center for Biotechnology
Investigation). Construction of multiple sequence align-
ments were carried out using Clustal XI 2.0 sequence
analysis software [47] (http://www.clustal.org/clustal2/).
2.2.2. Secondary Structure Prediction
Secondary structure was predicted using programs and
database available at website. Domains present were
defined by SMART (Simple Modular Architecture Re-
search Tool: http://smart.embl-h eidelberg.de/) and Pfam
(domains Proteins and families protein database:
http://www.sanger.ac.uk/resources/databases/pfam.html)
through UniProt (Universal Protein Resource:
http://www.uniprot.org/) data base.
2.2.3. Phylogene ti c Analysis
Neighbor joining trees were constructed from multiple
alignments using NJ plot software
http://pbil.u niv-lyon1.fr/software/njplot.html [48].
2.3. Pollination Assay and Epi-Fluorescence
Microscopy
For optical and fluorescence microscopy, individual open
flowers [floral stages as defined elsewhere [45,49] from
fresh wild-type or stressed inflorescences were dissected;
outer organs were removed using stainless steel needles
under dissection microscope. Pollination tests [50] were
performed on 30 pistils, fixed for 1 h in ethanol/acetic
acid 3:1 vol/vol]. After washing with distilled water
(three times), pistils were softened in 1 N NaOH for 10
min at 65˚C then neutralized in 50 mM phosphate buffer
saline (pH 7.5). Finally samples were stained for 2 hours
with decolorized aniline blue (Sigma) at 50 mg/ml in 50
mM phosphate buffer saline (pH 7.5) and mounted on
slides. As control of the specific stain, non-pollinated
stigmas were used. Examination and quantification by
epifluorescence microscopy (Olympus BX50) of adhering
and penetrating pollen grain in wild-type pistils compared
to GA3 treatment was performed using UV light (excita-
tion filter 395 nm and emission filter 420 nm).
2.4. RT-PCR
Total RNA was isolated using Trizol (Invitrogen). RNA
quality and concentration was measured by UV-spec-
trometry at 260, 230 and 280 nm, its integrity was
checked on 1.5% agarose gel and treated with DNaseI,
Rnase Free (Fermentas). First-strand cDNA was synthe-
sized from 2 µg of total RNA treated with DNase in 20
µl of reaction volume, using M-MuLV reverse transcript-
tase (Fermentas). One-tenth of the first-strand cDNA was
used as a template in a 25 µl PCR of 25 cycles (96˚C for
2 min, 94˚C for 1 min, 66.8˚C for 1 min and 72˚C for 1
min) using gene-specific primers. PCR products were
analyzed by electrophoresis in 2% agarose gels and visu-
alized with UV light before cDNA synthesis (First Strand
cDNA Synthesis, Fermentas). β-tubulin (At5g62700) was
used as internal control. Primers F1: GAGAATGCTGA
TGAGTGCATGG/R1: CAGGGAACCTCAGACAGCA
AGT (for Tubulin) and F2: AATCGCCGGGATCAAG
CACC/R2: GTGGCGGCGGAAATCTGGAG (for At5g
01830). DNA extraction: 50 mg of tissue was freeze in
liquid nitrogen and extensively pulverized using a mi-
cropestle. Genomic DNA extraction was carried out using

M. G. Acosta et al. / Advances in Bioscience and Biotechnology 3 (2012) 609-619 612
the NucleoSpin® Plant II Genomic DNA kit according to
manufacturer’s specifications. To check the genomic DNA
integrity a 1.5% agarose gel was prepared [51].
2.5. Western Blot
Total protein extracts from Arabidopsis thaliana were
obtained by N2-freezing and grinding 50 mg of floral
tissue according to [52]. Total protein concentration was
determined in the supernatant by the Bradford’s assay
[53], using BSA as standard. Samples were loaded on
two standards SDS-PAGE 10% [54], transferred to PVDF
membrane and to perform the western blot assay [51].
The primary antibody choice was based on previous
evaluation (WebLogo 3.0 software: http://weblogo.three
plusone.com/) of the amino acids residues conservation
degree in A. thaliana ARM repeats (not shown). Since it
exhibits a low-level of amino acid residues conservation,
we used an antibody that covers a wide area of ARM
repeats. Thus we choose the polyclonal antibody anti-
ARMC8 (H-300: sc-98534, Santa Cruz Biotechnology,
Inc.) since it recognizes 7 ARM repeats of the 14 present
in the protein. ARMC8 is a rabbit polyclonal antibody
directed against amino acids residues 311 - 610 mapping
within an internal region of ARMC8 of human origin.
2.6. Statistical Analysis
Statistical analysis was performed using test pollination
results carried out in stressed floral tissue (+GA) and
control floral tissue (−GA). The data were analyzed by a
one-way analysis of variance using the SAS software
(Statistical Analysis Systems, SAS. Institute, Inc., 1999).
Results of analysis of variance (ANOVA) and Tukey
mean differences test (α = 0.05) was performed for
number of pollen grains per stigma in plants with gibber-
ellin (+GA) and control plants (−GA).
3. RESULTS AND DISCUSSION
Earlier studies of the Arabido psis proteome have found
both large number of predict ARM repeat super-family
proteins as well as a variety of domain organizations
associated with ARM repeats [2,42,55-57]. The largest
class of ARM repeats family proteins belong to the PUB
proteins and some of them share very similar 3D struc-
tures (Figure 1; [2]). As was previously postulated by
Mudgil et al. 2004 [42], the fewer number of ARM re-
peats observed in AtPUBs and the 3D structural homol-
ogy exhibited by PUB16, PUB17 and ARC1 in our stud-
ies, may be related with the acquisition of new functions.
Most of the ARM repeats family proteins function as E3
ubiquitin-ligases [56] in the regulation of cell death [58]
and defense [59] mediating proteasome-dependent deg-
radation. This ubiquitin-proteasome pathway is used by
GA signaling pathway, like auxin and jasmonate ones, to
control gene expression through protein degradation [60,
[61]. Since GA behaves as a “florigen” for long-day
plants [62] and being a class of hormone involved in the
regulation of flower development in Arabidopsis [63],
we have analyzed how gene expression in flowering time
is affected both under normal growth conditions and GA
treatment. As antagonist phytohormone to GA, we de-
cided to use ABA, because it is highly linked to the ex-
pression of E3 ubiquitin ligases in other models [64,65].
To characterize these ARM repeat super-family pro-
teins, we performed western blot technique using ARMC8
as primary antibody. The immunoblot assay allowed us
to identify most of A. thaliana ARM repeat proteins,
grouped in three very well defined clusters in all stressed
plants (30 to 37 kDa; 55 to 60 kDa and 75 to 80 kDa).
Contrasting, only two bands were observed both under
normal growth conditions (55 to 60 kDa and 75 to 80
kDa) (not shown).
In order to determine whether it is a unique protein or
a cluster, we compare the molecular weights of 113 loci
for putative polypeptides available in TAIR website.
Accordingly, the candidates were grouped into 3 major
molecular weight clusters: group A, between 75 to 80
kDa; group B, between 55 to 60 kDa; and group C, be-
tween 30 to 37 kDa. Group A corresponds to five puta-
tive ARM repeat proteins: AT5G01830, AT1G60190,
AT5G67340, AT4G31520 and AT4G36550; group B
corresponds to the six putative ARM repeat proteins:
AT1G23940, AT4G31890, AT5G50900, AT5G22820,
AT2G45720 and AT3G1518; and group C corresponds
to eight putative ARM repeat proteins: AT3G43260,
AT4G15830, AT5G11550, AT3G58180, AT1G08315,
AT5G14510, AT3G01450 and AT1G15165. From this
study we can remark two important facts: first of all the
expression of ARM repeat proteins from groups A and B
were increased in stressed conditions and second, the
appearance of a new band corresponding to the group C
in stressed experiments. From these results we can con-
clude that the group C corresponds to ARM repeat pro-
teins expressed specifically in floral tissue under the
stress conditions evaluated.
Following was performed a bioinformatics search in
order to decide which of the three putative ARM repeat
protein groups must be focused for gene expression
studies. The alignment of 113 loci for putative polypep-
tides available in TAIR website was performed by com-
paring their amino acid residue sequence with the ARC1
ones. This comparison yielded 57 final candidates, 19 of
which have U-box sequences in addition to the ARM
sequences. Within this group, there are two protein se-
quences closely related to ARC1: AT1G29340 (PUB17)
and AT5g01830 (PUB16), been the very well-known
PUB17, the most closely related to ARC1, followed by

M. G. Acosta et al. / Advances in Bioscience and Biotechnology 3 (2012) 609-619 613
Figure 1. 3D structure and evolutionary relationship predictions of ARM repeat proteins. At the left:
PyMol molecular visualization tool where can be seen similarities in the spatial C-terminal ARM re-
peats folding pattern of: ACRE276, ARC1, PUB16 and PUB17 (Acosta 2010). At the right: is shown
the phylogenetic tree resulting from the evolutionary relationship between them. We used the soft-
ware available online iTol (Interactive tree of life [http://itol.embl.de/upload.cgi]) [77]. The Neighbour
Joining algorithm has been used to allow tree construction and indicated in each node the bootstrap
values. Evolutionary distance is shown in the upper right.
and their possible function has been inferred [59], we
decided to study PUB16, which according to the align-
ment and phylogenetic analysis is the other ARC1-like A.
thaliana ARM repeat protein.
PUB16. PUB17 function as putative E3 ubiquitin ligase
contains four ARM repeats and a U-box domain and it
was widely studied. Its functional tobacco homolog
ACRE276 is required for cell death and defense in So-
lanaceae [59]. The BLASTp alignment ARC1/PUB17
produced 58% identity and 74% similarity (E-value = 0)
and ARC1/PUB16 display 34% identity and 51% simi-
larity (E-value = 1e−75). Similarly, the scores obtained
from ClustalX were: PUB16/ARC1: 31; ACRE276/
PUB16: 35; PUB17/PUB16: 36; ACRE276/ARC1: 53;
PUB17/ARC1: 60 and ACRE276/PUB17: 68 (Figure 2).
PUB16 contains three ARM repeats and one U-box do-
main, so we can infer that it could functions as E3 ubiq-
uitin-ligase. However, similarity at the amino acid resi-
due does not allowed us to deduce similar functions in
pollen-stigma recognition mechanism in B. napus and A.
thaliana.
PUB16 could belong to the ARM repeat proteins from
the group A detected on western blot and their hypo-
thetical characterization was performed using the Uni-
Prot database (http://www.uniprot.o rg/) which freely
provides accessible resource of protein sequence and
functional information. The five sequences belonging to
the group A (AT4G31520, AT5G01830, AT1G60190,
AT5G67340 and AT4G36550) have been evidenced only
at transcriptional level. According to this result, we can-
not establish which of the five possible peptides corre-
spond to the expression band observed in our western
blot results and should be clarified in future experiments.
Therefore, as a first step, we decided to start the stud-
ies evaluating the PUB16 transcription levels in normal
and different stress conditions at the same flowering
stage. Expression studies using RT-PCR technique for
subsequent semi-quantification of PUB16 revealed that
in presence of GA3 1000 μM, there is a significant gene
expression of this molecule; while there is no expression
PUB17 is an E3 ubiquitin ligase and has been postulated
that it may form a signaling complex with a SRK1-like
kinase analogous to the SRK/ARC1/thioredoxin complex
in B. napus during rejection of self-incompatible pollen in
Brassica [36,66].
Because PUB17 has already been fully characterized

M. G. Acosta et al. / Advances in Bioscience and Biotechnology 3 (2012) 609-619 614
Figure 2. Multiple alignments between ACRE276, ARC1, PUB17 and PUB16. The sequences aligned were: Nt_ACRE276,
Bn_ARC1, At1g29340_PUB17 and At5g01830_PUB16. The default colour scheme is according to ClustalX. In grays box is shown
low scoring segments. An “*” (asterisk) indicates positions which have a single, fully conserved residue. A “:” (colon) indicates
conservation between groups of strongly similar properties—scoring > 0.5 in the Gonnet PAM 250 matrix. A “.” (period) indicates
conservation between groups of weakly similar properties—scoring ≤ 0.5 in the Gonnet PAM 250 matrix.
in normal growth conditions (−GA) neither in ABA (Fig-
ure 3) nor NaCl treatments (not shown).
Recent studies by Griffiths et al. 2007 [67] have dem-
onstrated that flowering genes only are expressed if the
repression system exercised by the nuclear proteins
DELLA is disassembled by GA signalling pathway. Ac-
cording to these, our PUB16 polypeptide could be in-
volved in a regulation pathway of proteosome degrada-
tion mediated by E3 ubiquitin ligases, specifically, down-
regulating genes involved in inhibition of SC.
Furthermore, the plant phenotypes were also affected
by the addition of exogenous GA. Stressed plants (+GA)
showed lower altitudes and flowered earlier compared to
those grown in normal conditions (−GA). This change in
the plant height corresponds to the classical effect of GA
that regulates growth and influences various develop-
mental processes, including stem elongation. These re-
sults are consistent with previously published studies
which demonstrate that in Arabidopsis, physiological and
genetic experiments have implicated GA specifically in
the autonomous pathway of flowering. Exogenous ap-
plication of GA accelerates flowering in wild type
Arabidopsis [68].
Finally, the morphological analysis was done to con-
firm if there is a significant increase of self-pollination in
GA sprayed flowers. This approach allowed us to cor-
roborate that A. thaliana L. is self-compatible with pol-
len grains produced by the same plant. When plants were
sprayed with GA, it was showed greater number of pol-
len grains germinated and adhered on stigmatic surface
(+GA) than control plants (−GA) (Figure 4). It is very
well known that the phytohormone GA regulates and
participates in development and fertility of A. thaliana L.
flowers. However, it is not clear how GA regulates the
late-stage development of floral organs after the estab-
lishment of their identities within floral meristems [63].
Our results does show that mRNA-PUB16 was spe-
cifically detected under hormonal stress by exogenous
GA (+GA) and they are absent without GA (−GA). Also,
by western blot, it was observed an increased expression
at the protein level in the five putative polypeptides,
classified in group A, among which could be expressed

M. G. Acosta et al. / Advances in Bioscience and Biotechnology 3 (2012) 609-619 615
Figure 3. RT-PCR: agarose gels stained with ethidium bromide Amplification of two
products: 241 bp (PUB16, at the top) and 151 bp (internal control β-tubulin, at the
bottom). Treatment with ABA 100 μM was performed for 2, 4, 8, 11 and 24 hours
but only internal control it was expressed, as well as in normal conditions (−GA).
Only with GA3 1000 μM (+GA) it was observed PUB16 gene expression. Positive
control: gDNA as PCR template; negative control: PCR without cDNA template (−).
Also, it was performed RT-PCR controls: RNA treated with and without DNase sub-
jected to retro-transcription (not shown).
Figure 4. Pollination in pistils with and without GA. (a) Analysis of variance using a conventional statistical test (Tukey mean differ-
ences test) allow to determine that the application of GA3 (+GA) in the plants increased significantly (p < 0.001) the number of pol-
len grains on pistils compared to plants sprayed without hormone (−GA). The quantitative analysis was carried out using self-polli-
nated flowers (state 13, Bowman 1994), they were classified into four classes according to the number of pollen grains (adhering and
tubes penetrating the stigma): 0 - 20, 21 - 40, 41 - 60 and >60 pollen grains. A notable increase in germinated pollen grains number
on the stigma under hormonal stress conditions can be clearly seen in images corresponding to aniline blue stained pollen grains on
the flower; (b) +GA and (c) −GA. Bar = 50 µm (ImageJ: http://rsbweb.nih.gov/ij/).
our PUB16 candidate.
Performing bioinformatics in-silico studies, we were
able to demonstrate that the secondary and tertiary struc-
tures of PUB16 putative protein, PUB17 and ARC1 ex-
hibit a highly similar pattern, suggesting similar func-
tions for both molecules. Like PUB17 and ACRE276
(functional homolog’s see Figure 1: ARM repeat protein
implicating the ubiquitin proteasome system in defenses
against pathogens in Nicotiana tabacum) could be E3
ligase activity required for plant cell death. Like ARC1,
in SI systems, PUB16 may be a signaling pathway player
in SC systems, even though in this particular interaction
mechanism, the expression level would be regulated by
GA.
The present work suggests that GA promotes PUB16
gene expression; however, since their target substrates
have not yet been identified, we cannot propose how it
works. Studies of GA signal transduction, using genetic
approaches, have led to the identification of positive and
negative signaling components [69]. Among these, the
most extensively characterized are the DELLA proteins.
The molecular mechanism by which DELLA proteins
suppress GA responses is not yet clear. The A. thaliana
genome contains five DELLA genes (RGA, GAI, RGL1,
RGL2, and RGL3). A major GA-signaling cascade has
been recently discovered [70]: GA binding to their solu-
ble GA receptor GAIN SENSITIVE DWARF1 (GID1),
triggering its interaction with DELLA proteins [67]. This
interaction stimulates binding of the DELLA proteins to
an E3 ubiquitin ligase via specific F-box proteins, lead-
ing to polyubiquitination and degradation of the DELLA
protein by the 26S proteosome. While this relatively
simple GA-signaling cascade involves three major play-
ers: a receptor, a DELLA protein, and a F-box protein,
other studies have identified additional factors that affect
GA responses [71]. It will be interesting to clarify
whether E3 ubiquitin ligases genes are simply the down-
stream targets of DELLA proteins or whether they may

M. G. Acosta et al. / Advances in Bioscience and Biotechnology 3 (2012) 609-619 616
also interact with DELLA proteins as region-specific
cofactors. Interactions studies have been used to identify
candidates [72] and in vitro ubiquitination assays can be
used to confirm the ability of E3 ligases to ubiquitinate
these potential substrates [73-75]. However, at present,
have not been identified yet the ARC1 potential targets.
Additionally, with the identification of the biological
roles of putative PUB proteins, the understanding about
how these E3 ligases are activated is an equally impor-
tant step in the elucidation of their physiological func-
tions.
4. CONCLUTIONS
ARM repeat super-family proteins, like related proteins
possessing this domain, may be involved in protein-pro-
tein interactions. The ARM repeat super-family proteins
analysis in this plant model, will allow a better under-
standing of the pollination cell biology and its possible
participation in their signaling pathways. Since there is
very little knowledge about GA signaling pathway, even
though they are proposed to be related to plants fertility,
it is very challenging to study which genes are expressed
under both stress or normal growth conditions, and also
it is important to temporal and functionally characterize
their behavior.
In this work, sequence comparison revealed significant
structural homology between ARC1 and PUB16. This
close relationship allows us to infer that similar transduc-
tion pathways might exist in two Brassicaceae species
differently involved in pollen hydration regulation and
their signaling mechanism of self and non-self pollen
recognition. Also, the results obtained here show the
ARM repeat super-family proteins clustering of A.
thaliana which is composed of three groups according to
molecular weights. According to our gene expression
studies, it appears that exogenous addition of GA cause
PUB16 gene expression, but this not happen in normal
condition growth or in ABA presence. Also, these results
are consistent with previous reports that postulate that,
plants ARM repeat super-family proteins expression is
subjected to both salt [50] or hormonal stresses [76].
Furthermore, these outcomes suggest that A. thaliana
could use some GA-signaling pathway which favors self-
pollination, fruit set and great seed production under
hormonal stress. Further analysis of ARM repeat super-
family proteins will improve understanding of their bi-
ology role related to its possible involvement in different
signaling pathways.
REFERENCES
[1] Coates, J.C. (2007) Plant cell monographs: Plant growth
signaling. Springer, Berlin, 299-314.
[2] Samuel, M., Salt, J., Shiu, S. and Goring, D. (2006) Mul-
tifunctional arm repeat domains in plants. International
Review of Cytology, 253, 1-26.
doi:10.1016/S0074-7696(06)53001-3
[3] Coates, J.C., Laplaze, L. and Haseloff, J. (2006) Arma-
dillo-related proteins promote lateral root development in
Arabidopsis. Proceedings of the National Academy of
Sciences USA, 103, 1621-1626.
doi:10.1073/pnas.0507575103
[4] González-Lamothe, R., Tsitsigiannis, D.I., Ludwig, A.A.,
Panicot, M., Shirasu, K. and Jones, J.D.G. (2006) The
U-box protein CMPG1 is required for efficient activation
of defense mechanisms triggered by multiple resistance
genes in tobacco and tomato. The Plant Cell, 18, 1067-
1083. doi:10.1105/tpc.106.040998
[5] Liu, P., Sherman-Broyles, S. and Nasrallah, M.E. (2007)
A cryptic modifier causing transient self-incompatibility
in Arabidopsis thaliana. Current Biology, 17, 734-740.
doi:10.1016/j.cub.2007.03.022
[6] Yan, J., Wang, J., Li, Q., Hwang, J.R., Patterson, C. and
Zhang, H. (2003) AtCHIP, a U-box-containing E3 ubiq-
uitin ligase, plays a critical role in temperature stress tol-
erance in Arabidopsis. Plant Physiology, 132, 861-869.
doi:10.1104/pp.103.020800
[7] Dong, J., Kim, S.T. and Lord, E.M. (2005) Plantacyanin
plays a role in reproduction in Arabidopsis. Plant Physi-
ology, 138,778-789. doi:10.1104/pp.105.063388
[8] Wheeler, M.J., Franklin-Tong, V.E. and Franklin, F.C.H.
(2001) The molecular and genetic basis of pollen-pistil
interactions. New Phytologist, 151, 565-584.
doi:10.1046/j.0028-646x.2001.00229.x
[9] Nasrallah, M.E., Liu, P., Sherman-Broyles, S., Boggs,
N.A. and Nasrallah, J.B. (2004) Natural variation in ex-
pression of self-incompatibility in Arabidopsis thaliana:
Implications for the evolution of selfing. Proceedings of
the National Academy of Sciences USA, 101, 16070-
16074. doi:10.1073/pnas.0406970101
[10] Sanchez, A.M., Bosch, M., Bots, M., Nieuwland, J.,
Feron, R. and Mariani, C. (2004) Pistil factors controlling
pollination. The Plant Cell, 16, S98-S106.
doi:10.1105/tpc.017806
[11] Huang, J., Zhao, L., Yang, Q. and Xue, Y. (2006) AhSSK1,
a novel SKP1-like protein that interacts with the S-locus
F-box protein SLF. The Plant Journal, 46, 780-793.
doi:10.1111/j.1365-313X.2006.02735.x
[12] Kusaba, M., Dwyer, K., Hendershot, J., Vrebalov, J.,
Nasrallah, J.B. and Nasrallah, M.E. (2001) Self-incom-
patibility in the genus Arabidopsis: Characterization of
the S locus in the outcrossing A. lyrata and its autoga-
mous relative A. thaliana. The Plant Cell, 13, 627-643.
[13] Heslop-Harrison, Y. and Shivanna, K.R. (1977) The re-
ceptive surface of the angiosperm stigma. Annals of Bot-
any, 41, 1233-1258.
[14] Dickinson, H. (1995) Dry stigmas, water and self-in-
compatibility in Brassica. Sexual Plant Reproduction, 8,
1-10. doi:10.1007/BF00228756
[15] Hulskamp, M., Kopczak, S.D., Horejsi, T.F., Kihl, B.K.
and Pruitt, R.E. (1995) Identification of genes required
for pollen-stigma recognition in Arabidopsis thaliana.

M. G. Acosta et al. / Advances in Bioscience and Biotechnology 3 (2012) 609-619 617
The Plant Journal, 8, 703-714.
doi:10.1046/j.1365-313X.1995.08050703.x
[16] Sampson, D.R. (1962) Intergeneric pollen-stigma incom-
patibility in Cruciferae. Canadian Journal of Genetics and
Cytology, 4, 38-49.
[17] Hiscock, S.J. and Dickinson, H.G. (1993) Unilateral in-
compatibility within the Brassicaceae: Further evidence
for the involvement of the self incompatibility (S)-locus.
Theoretical and Applied Genetics, 86, 744-753.
doi:10.1007/BF00222665
[18] Lelivelt, C.L.C. (1993) Studies of pollen grain germina-
tion, pollen-tube growth, micropylar penetration and seed
set in intraspecific and intergeneric crosses within three
Cruciferae species. Euphytica, 67, 185-197.
doi:10.1007/BF00040620
[19] Nasrallah, J.B. (2000) Cell-cell signaling in the self-in-
compatibility response. Current Opinion of Plant Biology,
3, 368-373. doi:10.1016/S1369-5266(00)00098-4
[20] Hill, J.P. and Lord, E.M. (1987) Dynamics of pollen tube
growth in the wild radish, Raphanus raphanistrum (Bras-
sicaceae) 2.Morphology, cytochemistry, and ultrastruc-
ture of transmitting tissues, and path of pollen tube growth.
American Journal of Botany, 74, 988-997.
doi:10.2307/2443938
[21] Elleman, C.J. and Dickinson, H.G. (1990) The role of the
exine coating in pollen-stigma interactions in Brassica
oleracea L. New Phytologist, 114, 511-518.
doi:10.1111/j.1469-8137.1990.tb00419.x
[22] Elleman, C.J., Franklin-Tong, V. and Dickinson, H.G.
(1992) Pollination in species with dry stigmas: The nature
of the early stigmatic response and the pathway taken by
pollen tubes. New Phytologist, 121, 413-424.
doi:10.1111/j.1469-8137.1992.tb02941.x
[23] Kandasamy, M.K., Nasrallah, J.B. and Nasrallah, M.E.
(1994) Pollen-pistil Interactions and developmental regu-
lation of pollen tube growth in Arabidopsis. Development,
120, 3405-3418.
[24] Hulskamp, M., Schneitz, K. and Pruitt, R.E. (1995b) Ge-
netic evidence for along-range activity that directs pollen
tube guidance in Arabidopsis. The Plant Cell, 7, 57-64.
[25] Lennon, K.A., Roy, S., Hepler, P.K. and Lord, E.M.
(1998) The structure of the transmitting tissue of Arabi-
dopsis thaliana (L.) and the path of pollen tube growth.
Sexual Plant Reproduction, 11, 49-59.
doi:10.1007/s004970050120
[26] Tsuchimatsu, T., Suwabe, K., Shimizu-Inatsugi, R., Iso-
kawa, S., Pavlidis, P., Stadler, T., Suzuki, G., Takayama,
S., Watanabe, M. and Shimizu, K. (2010) Evolution of
self-compatibility in Arabidopsis by a mutation in the
male specificity gene. Nature, 464, 1342-1346.
doi:10.1038/nature08927
[27] Bateman, A.J. (1955) Self-incompatibility systems in an-
giosperms. III. Cruciferae. Heredity, 9, 52-68.
doi:10.1038/hdy.1955.2
[28] Thompson, K.F. and Taylor, J.P. (1966) Non-linear domi-
nance relationships between S-alleles. Heredity, 21, 345-
362. doi:10.1038/hdy.1966.36
[29] Tarutani, Y., Shiba, H., Iwano, M., Kakizaki, T., Suzuki,
G., Watanabe, M., Isogai, A. and Takayama, S. (2010)
Trans-acting small RNA determines dominance relation-
ships in Brassica self-incompatibility. Nature, 466, 983-
986. doi:10.1038/nature09308
[30] Suzuki, G., Kai, N., Hirose, T., Fukui, K., Nishio, T.,
Takayama, S., Isogai, A., Watanabe, M. and Hinata, K.
(1999) Genomic organization of the S locus: Identifica-
tion and characterization of genes in SLG/SRK region of
S9 haplotype of Brassica campestris (syn. rapa). Genetics,
153, 391-400.
[31] Schopfer, C.R., Nasrallah, M.E. and Nasrallah, J.B. (1999)
The male determinant of self-incompatibility in Brassica.
Science, 286, 1697-1700.
doi:10.1126/science.286.5445.1697
[32] Takayama, S., Shiba, H., Iwano, M., Shimosato, H., Che,
F.S., Kai, N., Watanabe, M., Suzuki, G., Hinata, K. and
Isogai, A. (2000) The pollen determinant of self-incom-
patibility in Brassica campestris. Proceedings of the Na-
tional Academy of Sciences USA, 97, 1920-1925.
[33] Takayama, S., Shimosato, H., Shiba, H., Funato, M., Che,
F.S., Watanabe, M., Iwano, M. and Isogai, A. (2001) Di-
rect ligand-receptor complex interaction controls Bras-
sica self-incompatibility. Nature, 413, 534-538.
doi:10.1038/35097104
[34] Shiba, H., Takayama, S., Iwano, M., Shimosato, H., Fu-
nato, M., Nakagawa, T., Che, F., Suzuki, G., Watanabe,
M., Hinata, K. and Isogai, A. (2001) A pollen coat pro-
tein, SP11/SCR, determines the pollen S-specificity in the
self-incompatibility of Brassica species. Plant Physiology,
125, 2095-2103. doi:10.1104/pp.125.4.2095
[35] Stone, S.L., Anderson, E.M., Mullen, R.T. and Goring,
D.R. (2003) ARC1 is an E3 ubiquitin ligase and promotes
the ubiquitination of proteins during the rejection of self-
incompatible Brassica pollen. The Plant Cell, 15, 885-
898. doi:10.1105/tpc.009845
[36] Gu, T.S., Mazzurco, M., Sulaman, W., Matias, D.D. and
Goring, D.R. (1998) Binding of an arm repeat protein to
the kinase domain of the S-locus receptor kinase. Pro-
ceedings of the National Academy of Sciences USA, 95,
382-387.
[37] Samuel, M.A., Mudgil, Y., Salt, J.N., Delmas, F.,
Ramachandran, S., Chilelli, A. and Goring, D.R. (2008)
Interactions between the S-domain receptor kinases and
AtPUB-ARM E3 ubiquitin ligase ssuggest a conserved
signaling pathway in Arabidopsis. Plant Physiology, 147,
2084-2095. doi:10.1104/pp.108.123380
[38] Murase, K., Shiba, H., Iwano, M., Che, F.S., Watanabe,
M., Isogai, A. and Takayama, S. (2004) A membrane-
anchored protein kinase involved in Brassica self-in-
compatibility signaling. Science, 303, 1516-1519.
doi:10.1126/science.1093586
[39] Kakita, M., Murase, K., Iwano, M., Matsumoto, T., Wa-
tanabe, M., Shiba, H., Isogai, A. and Takayama, S. (2007)
Two distinct forms of M-locus protein kinase localize to
the plasma membrane and interact directly with S-locus
receptor kinase to transducer self-incompatibility signal-
ing in Brassica rapa. The Plant Cell, 19, 3961-3973.
doi:10.1105/tpc.106.049999
[40] Kakita, M., Shimosato, H., Murase, K., Isogai, A. and

M. G. Acosta et al. / Advances in Bioscience and Biotechnology 3 (2012) 609-619 618
Takayama, S. (2007) Direct interaction between the S-
locus receptor kinase and M locus protein kinase in-
volved in Brassica self-incompatibility signaling. Plant
Biotechnology, 24, 185-190.
doi:10.5511/plantbiotechnology.24.185
[41] Riggleman, B., Wieschaus, E. and Schedl, P. (1989) Mo-
lecular analysis of the armadillo locus: Uniformly distrib-
uted transcripts and a protein with novel internal repeats
are associated with a Drosophila segment polarity gene.
Genes Development, 3, 96-113. doi:10.1101/gad.3.1.96
[42] Mudgil, Y., Shiu, S.H., Stone, S.L., Salt, J.N. and Goring,
D.R. (2004) A large complement of the predicted Arabi-
dopsis ARM repeat proteins are members of the U-box
E3 ubiquitin ligase family. Plant Physiology, 134, 59-66.
doi:10.1104/pp.103.029553
[43] Acosta, M.G., Langhi, D., Lassaga, S.L. and Casco, V.H.
(2010a) Bioinformatics and morphological studies of pol-
lination mechanism as a process of cell-cell adhesion in
Arabidopsis thaliana. Agricultural Science Magazine, 14,
3-15.
[44] Epstein, E. (1972) Mineral nutrition of plants: Principles
and perspectives. J. Wiley and Sons, Inc., New York, 68-
82.
[45] Bowman, J. (1994) Arabidopsis: An atlas of morphology
and development. Springer-Verlag, New York, 258-259.
[46] Banzai, T., Hershkovits, G., Katcoff, D.J., Hanagata, N.,
Dubinsky, Z. and Karube, I. (2002) Identification and
characterization of mRNA transcripts differentially ex-
pressed in response to high salinity by means of differen-
tial display in the mangrove, Bruguiera gymnorrhiza.
Plant Science, 162, 499-505.
doi:10.1016/S0168-9452(01)00601-X
[47] Thompson, J.D., Higgins, D.G. and Gibson, T.J. (1994)
CLUSTAL W: Improving the sensitivity of progressive
multiple sequence alignment through sequence weighting,
position-specific gap penalties and weight matrix choice.
Nucleic Acids Research, 22, 4673-4680.
doi:10.1093/nar/22.22.4673
[48] Perriere, G. and Gouy, M. (1996) www-query: An on-line
retrieval system for biological sequence banks. Biochimie,
78, 364-369. doi:10.1016/0300-9084(96)84768-7
[49] Smyth, D.R., Bowman, J.L. and Meyerowitz, E.M. (1990)
Early flower development in Arabidopsis. The Plant Cell,
2, 755-767.
[50] Eschrich, W. and Currier, H.B. (1964) Identification of
callose by it diachrome and fluorchrome reactions. Stain
Technology, 39, 308-309.
[51] Sambrook, D.W. and Russell, J. (2001) Molecular clon-
ing: A laboratory manual. Cold Spring Harbor Laboratory
Press, New York, 102-114.
[52] Weigel, D. (2002) Arabidopsis: A laboratory manual.
Cold Spring Harbor Laboratory Press, New York, 102-
145.
[53] Bradford, M.M. (1976) Rapid and sensitive method for
the quantitation of microgram quantities of protein utiliz-
ing the principle of protein-dye binding. Analytical Bio-
chemistry, 72, 248-254.
doi:10.1016/0003-2697(76)90527-3
[54] Laemmli, U.K. (1970) Cleavage of structural proteins
during the assembly of the head of bacteriophage T4.
Nature, 227, 680-685. doi:10.1038/227680a0
[55] Azevedo, C., Santos-Rosa, M.J. and Shirasu, K. (2001)
The U-box protein family in plants. Trends in Plant Sci-
ence, 6, 354-358. doi:10.1016/S1360-1385(01)01960-4
[56] Andersen, P., Kragelund, B.B., Olsen, A.N., Larsen, F.H.,
Chua, N., Poulsen, F.M. and Skriver, K. (2004) Structure
and biochemical function of aprototypical Arabidopsis
U-box domain. Journal of Biological Chemistry, 279,
40053-40061. doi:10.1074/jbc.M405057200
[57] Wiborg, J., O’Shea, C. and Skriver, K. (2008) Biochemi-
cal function of typical and variant Arabidopsis thaliana
U-box E3 ubiquitin-protein ligases. Biochemical Journal,
413, 447-457. doi:10.1042/BJ20071568
[58] Thomas, S.G. and Franklin-Tong, V.E. (2004) Self-in-
compatibility triggers programmed cell death in Papaver
pollen. Nature, 429, 305-309. doi:10.1038/nature02540
[59] Yang, C.W., González-Lamothe, R., Ewan, R.A., Row-
land, O., Yoshioka, H., Shenton, M., Ye, H., O’Donnell,
E., Jones, J.D.G. and Sadanandom, A. (2006) The E3
ubiquitin ligase activity of Arabidopsis PLANTU-BOX17
and its functional tobacco homolog ACRE276 are re-
quired for cell death and defense. The Plant Cell, 18,
1084-1098. doi:10.1105/tpc.105.039198
[60] Itoh, H., Ueguchi-Tanaka, M., Sato, Y., Ashikari, M. and
Matsuoka, M. (2002) The gibberellin signaling pathway
is regulated by the appearance and disappearance of
SLENDER RICE1 in nuclei. The Plant Cell, 14, 57-70.
doi:10.1105/tpc.010319
[61] Spartz, A.K., Lee, S.H., Wenger, J.P., Gonzalez, N., Itoh,
H., Inzé, D., Peer, W.A., Murphy, A.S., Overvoorde, P.J.
and Gray, W.M. (2012) The SAUR19 subfamily of
SMALL AUXIN UP RNA genes promote cell expansion.
The Plant Journal, 70, 978-990.
doi:10.1111/j.1365-313X.2012.04946.x
[62] Komeda, Y. (2004) Genetic regulation of time to flower-
ing Arabidopsis thaliana. Annual Review of Plant Biol-
ogy, 55, 521-535.
doi:10.1146/annurev.arplant.55.031903.141644
[63] Yu, H., Ito, T., Wellmer, F. and Meyerowitz, E.M. (2004)
Floral homeotic genes are targets of gibberellins signaling
in flower. Proceedings of the National Academy of Sci-
ences USA, 101, 7827-7832.
[64] Weiss, D. and Ori, N. (2007) Mechanisms of cross talk
between gibberellin and other hormones. Plant Physiol-
ogy, 144, 1240-1246. doi:10.1104/pp.107.100370
[65] Acosta, M.G., Ahumada, M.A., Lassaga, S.L. and Casco,
V.H. (2010b) Abiotic stress effect on gene expression of
ARM repeats proteins in A. thaliana. Book of Abstracts—
XXIII Meeting Argentina Plant Physiology, 1, 205.
[66] Cabrillac, D., Cock, J.M., Dumas, C. and Gaude, T. (2001)
The S locus receptor kinase is inhibited by thioredoxins
and activated by pollen coat proteins. Nature, 410, 220-
223. doi:10.1038/35065626
[67] Griffiths, J., Murase, K., Rieu, I., Zentella, R., Zhang,
Z.L., Powers, S.J., Gong, F., Phillips, A.L., Hedden, P.
and Sun, T.P. (2007) Genetic characterization and func-

M. G. Acosta et al. / Advances in Bioscience and Biotechnology 3 (2012) 609-619 619
tional analysis of the GID1 gibberellin receptors in Arabi-
dopsis. The Plant Cell, 18, 3399-3414.
doi:10.1105/tpc.106.047415
[68] Blazquez, M.A., Green, R., Nilsson, O., Sussman, M.R.
and Weigel, D. (1998) Gibberellins promote flowering of
Arabidopsis by activating the LEAFY promoter. The Plant
Cell, 10, 791-800.
[69] Sun, T.P. and Gubler, F. (2004) Molecular mechanism of
gibberellin signaling in plants. Annual Review of Plant
Biology, 55, 197-223.
doi:10.1146/annurev.arplant.55.031903.141753
[70] Ueguchi-Tanaka, M., Ashikari, M., Nakajima, M., Itoh,
H., Katoh, E., Kobayashi, M., Chow, T.Y., Hsing, Y.I.,
Kitano, H. and Yamaguchi, I. (2005) GIBBERELLIN
INSENSITIVE DWARF1 encodes a soluble receptor for
gibberellin. Nature, 437, 693-698.
doi:10.1038/nature04028
[71] Hartweck, L.M. and Olszewski, N.E. (2006) GIBBEREL-
LIN INSENSITIVE DWARF1 is a gibberellin receptor
that illuminates and raises questions about GA signaling.
The Plant Cell, 18, 278-282. doi:10.1105/tpc.105.039958
[72] Yee, D. and Goring, D.R. (2009) The diversity of PUB
E3 ubiquitin ligases: From upstream activators to down-
stream target substrates. Journal of Experimental Botany,
60, 1109-1121. doi:10.1093/jxb/ern369
[73] Cho, S.K., Chung, H.S., Ryu, M.Y., Park, M.J., Lee,
M.M., Bahk, Y.Y., Kim, J., Pai, H.S. and Kim, W.T.
(2006) Heterologous expression and molecular and cellular
characterization of CaPUB1 encoding a hot pepper U-
BoxE3 ubiquitin ligase homolog. Plant Physiology, 142,
1664-1682. doi:10.1104/pp.106.087965
[74] Cho, S.K., Ryu, M.Y., Song, C., Kwak, J.M. and Kim,
W.T. (2008) Arabidopsis PUB22 and PUB23 are ho-
mologous U-box E3 ubiquitin ligases that play combina-
tory roles in response to drought stress. The Plant Cell,
20, 1899-1914. doi:10.1105/tpc.108.060699
[75] Shen, G., Yan, J., Pasapula, V., Luo, J., He, C., Clarke,
A.K. and Zhang, H. (2007) The chloroplast protease sub-
unit ClpP4 is a substrate of the E3 ligase AtCHIP and
plays an important role in chloroplast function. The Plant
Journal, 49, 228-237.
doi:10.1111/j.1365-313X.2006.02963.x
[76] Alonso-Ramírez, A., Rodríguez, D., Reyes, D., Jiménez,
J.A., Nicolás, G., López-Climent, M., Gómez-Cadenas, A.
and Nicolás, C. (2009) Cross-talk between gibberellins
and salicylic acid in early stress responses in Arabidopsis
thaliana seeds. Plant Signal Behavior, 4, 750-751.
doi:10.4161/psb.4.8.9175
[77] Letunic, I. and Bork, P. (2007) Interactive tree of life
(iTOL): An on line tool for phylogenetic tree display and
annotation. Bioinformatics, 23, 127-128.
doi:10.1093/bioinformatics/btl529
ABBREVIATIONS
ARM: armadillo
PUB: plant U-box
ARC1: armadillo-repeats containing protein-1
SRK: S-locus receptor kinase
SLG: S-locus glycoprotein