Vol.3, No.2, 133-138 (2013) Stem Cell Discovery
http://dx.doi.org/10.4236/scd.2013.32018
Direct pre-differentiation of rat mesenchymal stem
cells into dopaminergic cells
Judith Zavala-Arcos1, Maria Teresa Gonzalez-Garza1*, Janet Gutierrez-Alcala1,
Hector R. Martinez2, Jorge E. Moreno-Cuevas1
1Servicio de Terapia Celular, School of Medine and Health, CITES, Tecnológico de Monterrey, Monterrey, México;
*Corresponding author:
2Servicio de Neurologia, Hospital San José Tec de Monterrey, Monterrey, México
Received 19 February 2013; revised 25 March 2013; accepted 15 April 2013
Copyright © 2013 Judith Zavala-Arcos et al. This is an open access article distributed under the Creative Commons Attribution Li-
cense, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
ABSTRACT
The use of stem cells has been proposed as an
alternative treatment for certain neurodegenera-
tive disorders. It has also be en suggested th at in
the pre-differentiated state, stem cells might
provide a better therapeutic option than cells
that are undifferentiated or fully differentiated.
The purpose of this study was to develop a
protocol aimed at reducing the incubation time
required to induce the conversion of rat mes-
enchymal stem cells into immature dopaminer-
gic neurons. Stem cells obtained from rat bone
marrow were incubated in a control or induction
media for 2 - 24 h. Cells incubated for 24 h in
induction medium demonstrated an increase on
the levels of the neuronal protein markers nestin,
glial fibrillary acid protein, and β-tubulin III, as
well as increases in the expression of Pax3, EN1,
Thy1.1, and GEF10 genes. This manuscript pre-
sent s evidence that adult mesenchy mal cells are
capable to respond, in a short time period, to a
neuroinduction medium, and give raise to pre-
differentiated neuron like cells representing an
alternative for Parkinson disease cell therapy
transplantation.
Keywords: Cell Differentiation; Dopamine
Producing Ce l ls; N euro-Differentiation; Parkinson’s
Disease; Stem Cells
1. INTRODUCTION
Parkinson disease is a major neurodegenerative dis-
ease of the nervous system. It is characterized by motor
disability as a consequence of nigral neuronal death [1].
Pharmacological correction of the brain dopamine deficit
constitutes the first line of treatment for affected patients.
Unfortunately, this therapy does not stop the progression
of the disease. Other treatment options include deep sur-
gical brain stimulation [2]. Cell therapy has been pro-
posed as an alternative for treatment of this neurodegen-
erative disorder due to the fact that significant clinical
signs are caused by specific and selective loss of ni-
grostriatal dopaminergic neurons. The possibility of re-
placing those cells has been explored through the trans-
plantation of embryonic stem cells (ESCs), fetal stem
cells, induced pluripotential stem cells (iPSCs), and
mesenchymal stem cells (MSCs) in animal models. Of
these, ESCs proved to be capable to differentiate into
dopaminergic neurons, after transplantation into the
striatum in Parkinson disease rat models [3-6]. Human
clinical trials reported variable responses; in patients
implanted with ESCs into the putamen, significant clini-
cal improvements were observed based on standardized
tests for Parkinson disease [7]. Improvements have been
assessed in human subjects by either evaluations in their
motor function, or by the reduction of daily L-dopa dos-
ing [8-9]. However, this approach has not been widely
accepted. Besides ethical concerns, a large amount of
tissue is needed for each patient, because only 3% - 20%
of transplanted cells survive [10-12].
Reprogramm ing s omat ic cells to pluri pot ency gi ves the
opportunity to obtain iPSCs as a viable alternative for cell
therapy in patients with Parkinson disease [13-15]. Al-
though important results have been obtained with ESCs,
fetal stem cells and iPSCs, these cells present ethical and
genetic problems that need to be fully addressed before
they could be considered for clinical application.
On the other hand, MSCs do not present any of those
ethical concerns. To prove its possible efficacy as an al-
ternative treatment for Parkinson disease, several studies
have been performed in an animal model. Results
showed that grafted undifferentiated human MSCs ex-
erted neuroprotective effects against nigrostriatal degen-

J. Zavala-Arcos et al. / Stem Cell Discovery 3 (2013) 133-138
134
eration induced by 6-hydroxydopaminehydr obromide (6-
OHDA), but did not transform into functional dopa-
miner gi c neu rons [16,17].
Although MSCs do not present ethical concern, it has
been reported that prolonged in vitro culture could in-
creased genetic and epigenetic abnormalities, therefore, it
is important to consider their use on the first passages
[18]. The general aim of this study was to develop a pro-
tocol to induce rat bone marrow MSCs conversion into
immature neural dopaminergic-like cells in short time
periods.
2. METHODS
2.1. Ethics Statement
Animal studies were performed after approved by the
Animal Ethics Committee from the Medical School at
the “Instituto Tecnológico y de Estudios Superiores de
Monterrey” (ITESM), Reg. 2009-Re-001. All surgeries
performed in the animals were under anesthesia and all
efforts were made to minimize animal suffering. Animals
were housed five per cage at 20˚C - 22˚C on a 12/12 h
light/dark cycle, with food and water ad libitum.
2.2. Mesenchymal Cell Isolation and Culture
MSCs were obtained from adult male Wistar rats,
weighing ~220 g. Hank’s balanced salt solution (Gibco,
Grand Island, NY) was used to extrude the bone marrow
from femurs and the suspension was filtered using a 70
μm pore size cell strainer (BD Falcon, Bedford, MA).
After centrifugation, cells were resuspended in Dul-
becco’s modified Eagle’s medium (DMEM-F12; Gibco)
containing 20% fetal bovine serum (FBS; Gibco) and 1%
antibiotics (streptomycin-penicillin) (Gibco). Cells were
seeded in 100 mm culture dishes (Corning Inc., New
York, NY) at 37˚C and 5% CO2 in a humid chamber for
24 h. To remove nonadherent cells, cultures were washed
with phosphate-buffered saline (PBS; pH 7.4) and the
culture medium was replaced with DMEM-F12 contain-
ing 10% FBS and 1% antibiotics.
2.3. Control Medium (CM)
Before induction, cells on their fourth passage were
placed in DMEM-F12 containing 5% FBS and 1% anti-
biotics for 24 h, which was used as the CM. Cells were
then washed with PBS (pH 7.4) and the medium was
replaced with induction medium (IM).
2.4. Induction Medium (IM)
IM consisted of CM plus 0.1 μM RA (Sigma-Aldrich,
St. Louis, MO), 1 mM
β -mercaptoethanol (Sigma-Al-
drich), 2 mM glutamine (Invitrogen, Grand Island, NY),
10 ng/mL fibroblast growth factor 8 (FGF8) (Sigma-
Aldrich), 0.2% dimethyl sulfoxide (Sigma-Aldrich), 40
ng/mL of epithelial growth factor (Invitrogen), 0.5 mM
3-isobutyl-1-methylxanthine (Sigma-Aldrich), 5 μg/mL
insulin-transferrin-selenium (Gibco), 2 μg/mL heparin
(Pisa, Guadalajara, Jal, Mexico), 10 ng/mL brain-derived
neurotrophic factor (Invitrogen), 4.5 mg/mL glucose
(Sigma-Aldrich ) and 10 ng /mL of son ic he dgehog ( SHH)
protein (R& D Sy st ems, Minneapolis, MN ).
2.5. Immunocytochemistry
Circular glass slides treated with poly-L-lysine
(Sigma-Aldrich) were placed in 24-well microplates
(Corning Inc.) for immunocytochemistry and cells were
cultured at a density of 1 × 105 cells/well for 2 or 24 h.
Cells were fixed in 4% paraformaldehyde for 10 min and
were washed three times with PBS (pH 7.4). Cells were
permeabilized using 0.3% Triton X-100 in PBS for 5 min.
Non-specific antibody reactions were blocked with 5%
BSA in PBS for 1 h. Next, cells were incubated over-
night at 4˚C with primary mouse monoclonal antibodies
diluted in PBS containing 1% BSA. The used mono-
clonal mouse antibodies and dilutions were anti-nestin
(10 μg/mL; R&D Systems), anti-glial fibrillary acid pro-
tein (GFAP) (5 μg/mL; Chemicon International Inc.,
Billerica, MA), anti-conjugated dopamine (1:5000; Se-
rotec, Kidlington, Oxford, UK) and anti-
β -tubulin III
(1:2000; Promega, Madison, WI). Cells were washed
three times with PBS and incubated with secondary goat
anti-mouse Fc-fluorescein isothiocyanate (1:400; Thermo
Fisher Scientific, Pierce Biotechnology, Rockford, IL)
for 2 h in the dark. Cells were incubated for 1 min in
propidium iodide (0.01 mg/mL; Fluka, Toluca, Mexico)
to counterstain the nuclei. Cells were analyzed using a
fluorescence microscope (Imager Z1; Zeiss, Jena, Ger-
many). Images were obtained using an Axiocam HRm
camera system (Zeiss, New York, NY) coupled to the
microscope.
2.6. RNA Isolation and Reverse
Transcription Polymerase Chain
Reaction (RT-PCR)
MSCs were cultured in six-well microplates (Corning
Inc.) treated with poly-L-lysine at a density of 5 × 105
cells/well for 2 or 24 h. Total RNA was isolated from
undifferentiated mesenchymal cells and cells incubated
in induction media using a binding silica column kit
(GenElute Mammalian Total RNA; Sigma-Aldrich). The
amount and quality of RNA was determined using a
GeneQuant pro spectrophotometer (Amersham Biosci-
ences, Cambridge, UK). RT-PCR was performed using a
PX2 Thermo thermal cycler (Thermo Fisher Scientific),
one-step reactions (Qiagen, Crawley, UK). All primers
were obtained from MWG-Biotech, Huntsville, A L , USA ,
and are described on Table 1.

J. Zavala-Arcos et al. / Stem Cell Discov ery 3 (2013) 133-138 135
Table 1. Primers used for RT-PCR gene detection.
Gene Sense Antisense
GAPDH GGTGAAGGTCGGTGTGA CATGAGCCCTTCCACGA
En1 TCAAAACTGACTCGCAGCA ACTCCGCCTTGAGTCTCTGC
Pax3 GCCTCAGACCGACTATGCTC CCACGGCTTACTTTGTCCAT
Thy1.1 CAGGGCTGCTGTCTTCCTAC GGGCTGTCCAGTACGTCAAT
AADC GGATTCAGGGCTTATCACTGACTACC TTCATTCACTTTGTTGGAACCCTTTAGC
Aldh1 TGTTAGCTGATGCCGACTTG TTCTTAGCCCGCTCAACACT
GEF10 CAGGGCTGCTGTCTTCCTAC GGGCTGTCCAGTACGTCAAT
The GAPDH gene served as an internal control.
RT-PCR reactions were performed in a final volume of
50 μL using 1 μg of total RNA, according to the Qiagen
One-Step RT-PCR protocol. Reverse transcription was
performed at 50˚C for 30 min. PCR conditions were:
activation at 95˚C for 1 min, 35 cycles of amplification
(1 min at 94˚C, 1 min at 60˚C (54.6˚C for GAPDH) and
1 min at 72˚C) and 10 min at 72˚C for final extension.
PCR reactions were resolved on 2% agarose gels. The
bands were observed under ultraviolet (UV) light and
photographed in a UVP High Performance UV Transil-
luminator (Di g iDocIt, Cambridge, UK).
3. RESULT S Figure 1. Immunofluorescence microscopy of MSCs cultured
in control medium or induction medium. (A) Nestin detection
(green) in cells incubated in control medium; (B) Cells incu-
bated in induction medium for 2 h and (C) cells incubated in
induction medium for 24 h; (D) Tubulin detection (green) in
cells incubated in control medium; (E) in induction medium for
2 h and (F) in induction medium for 24 h; (G) Glial fibrillary
acid protein (GFAP) detection in cells incubated in control
medium; (H) in induction medium for 2 h and (I) in induction
medium for 24 h. Nuclei are counterstained with propidium
iodide (red).
3.1. Immunocytochemical Detection of
Neural Proteins
Immunohistochemistry was performed to determine
whether an association existed between the morphologi-
cal changes observed in cells, and the expression of pro-
teins related to neural lineages. Fluo rescence microscopy
analysis showed a slight po sitive nestin signal around the
nuclei of MSCs cultured in CM (Figure 1(A)). Some
MSCs incubated with IM showed a significant increase
in nestin after 2 h of induction (Figure 1(B)). After 24 h
of incubation in IM, most of the MSCs showed positive
expression for nestin in the cytoplasm (Figure 1(C)).
Immunocytochemistry for
β -tubulin III showed a similar
distribution: some of the MSCs incubated in CM showed
a thin fibrous pattern surrounding the nucleus (Figure
1(D)). After 2 h in IM, most of the MSCs became posi-
tive (Figure 1(E)) and those incubated in IM for 24 h
showed a marked increase in the fibrous pattern
throughout the cytoplasm (Figure 1(F)). Immunochem-
istry for GFAP showed an abundant expression of the
protein, even in MSCs incubated in CM (Figure 1(G)).
After 2 h, this staining became more abundant (Figure
1(H)) and after 24 h of incubation in IM, abundant GFAP
distribution throughout the cytoplasm was observed, al-
lowing us even to detect dendritic extensions on the cell
surface as well as cell interconnections (Figure 1(I)). Do-
pamine detection was negative on MSCs cultured in CM
as well as in MSCs incubated in IM for 2 h; however,
after 24 h, the neurotransmiter was detected inside small
cytoplasm vesicles (Figur e 2).
3.2. Expression of Neural Genes
We evaluated the expression of genes for the following
neural markers: Pax3, En1, GEF10 and Aldh1. Results
showed positive expression for Pax3 and En1 in cells
cultured in CM, as well as in IM, without apparent in-
creases in the expression of those genes as a result of
incubation in either medium. GEF10 gene expression
was not detected from cells cultured in CM or IM after 2
h; however, after culture in IM for 24 h, expression was
detected. Expression of the gene for Aldh1 was not de-
tected with any medium on cells. The cells were also ana-
OPEN AC CESS

J. Zavala-Arcos et al. / Stem Cell Discovery 3 (2013) 133-138
136
Figure 2. Immunofluorescence detection of dopamine in MSCs.
(A) MSCs after 2 h of culture in induction medium. No dopa-
mine was detected. Propidium iodide was used to counterstain
nuclei (orange); (B) Representative images showing the pres-
ence of conjugated dopamine (green) in MSCs cultured in ex-
perimental media to induce neurodifferentiation; dopamine
immunostaining appears as small vesicles (arrows) in the cyto-
plasm. Scale bar = 20 μm.
lyzed for AADC and Thy1.1 gene expression to de termine
whether they belonged to a dopaminergic lineage. Gel
analysis showed positive expression levels for Thy1.1 in
cells incubated in IM for 24 h. AADC gene expression
was negative for all media (Figure 3).
4. DISCUSSION
Previous studies with adult hMSCs have demonstrated
that these cells express neural genes at low, nonfunc-
tional basal levels, suggesting that they have a neural
predisposition [19]. Several culture media have been
proposed to induce MSCs into neuron-like cells. Those
media have been supplemented with chemicals and bio-
logical growth factors, such as DMSO, SHH, FGF8 and
RA. Media containing chemicals such as DMSO have
raised some questions about the effective differentiation
observed in terms of cell morpholog y. Authors claim that
these morphological changes could be artifacts induced
by the direct effect of this compound on the cytoskeleton
[20]. Regardless of this presumption, it has been demon-
strated that such changes in the cytoskeleton can stimu-
late the expression of neural genes [21-24]. Nevertheless,
in order to avoid these possible toxic and artificial effects,
DMSO concentrations included in the IM were reduced
by one order of magnitude from that previously reported
to induce morphological changes [20] in the present
study. The IM used in our protocol also contained SHH
and FGF8. It has been shown that during mammalian
embryogenesis, an interaction between SHH and FGF8
induces the development of the most important dopa-
mine-synthesizing areas: the substantia nigra and the
ventral tegmental area (VTA) [25,26]. SHH signaling
also plays a role in axonal projection of dopaminergic
neurons from the substantia nigra and the VTA to rostral
target tissue, which plays an essential role in mammalian
motor neurons [27]. Another factor added to our IM was
BDNF, which plays a role in phenotypic maturation and
increases the survival of dopaminergic neurons in the
Figure 3. Reverse transcription polymerase
chain reaction (RT- PCR) assays for En1, Pax3,
Thy1.1, GEF10 and GAPDH expressions. (CM)
RT-PCR from MSCs cultured in control me-
dium. (IM) RT-PCR from MSCs cultured in
induction medium for 2 h and 24 h. En1 ex-
pression was detected in all media, as well as
Pax3. Thy1.1 and GEF10 were only detected
after 24 h of incubation in induction medium.
developing substantia nigra [28,29]. This evidence infers
that the presence of BDNF, SHH, and FGF8 in IM may
have enhanced the expression of dopaminergic neural
markers.
After 2 h of incubation in IM, there were some mor-
phological changes and an increased concentration of
neural markers such as GFAP,
β -tubulin III, and nestin.
After 24 h of cultiv ation with IM, no t only th ose pro teins
showed a notable concentration increase but the expres-
sion of the genes encoding TH, GEF 10 and Pax3 were
also detected. We looked for the presence of these pro-
teins for their known participation during neuron differ-
entiation.
Pax3 plays an important role in pattern formation in
the vertebrate central nervous system and in the mor-
phological differentiation of neural cells [30,31], as well
as in the production of tyrosine hydroxylase. Tyrosine
hydroxylase is the rate-limiting enzyme for dopamine
synthesis in mature dopaminergic neurons [32]. GEF10
belongs to the guanine nucleotide exchange factor family
and plays a role in the connectivity and morphogenesis
of neural cells, including axonal growth, dendrite elabo-
ration, plasticity, and synapse formation [33,34]. En1
maintains the survival of mature midbrain dopaminergic
neurons in a terminal differentiation state during neuro-
genesis [35]. In this study, cells were positive for the
intermediate filament, nestin, which is expressed during
the early developmental stage by neural progenitor cells
and downregulated upon differentiation [30,35]. This

J. Zavala-Arcos et al. / Stem Cell Discov ery 3 (2013) 133-138 137
could reflect an ongoing stage of maturity of cells cul-
tured in IM for 24 h.
The presence of all of those markers indicates an im-
mature neuronal state, which is desirable for transplanta-
tion programs, for it has been reported that immature
cells could be a better therapeutic option than mature
cells in allowing engraftment [36,37]. It is noteworthy
that cells cultured for 2 4 h in IM showed conjugated do-
pamine distributed in smaller cytoplasmic inclusions
detected by immunocytochemistry and this was consis-
tent with an elevated expression of Thy1.1, according to
our RT-PCR analysis. However, further research using
specific markers of dopamine vesicles such as vesicular
monoamine transporter 2 is required to verify whether
the visualized deposits are presynaptic vesicles.
More detailed experiments are required to elucidate
the pathway by which dopamine is synthesized in in-
duced MSCs.
Aldh1 is an enzyme related to RA synthesis and is a
marker of midbrain dopaminergic neurons in the late
stages of fetal development and adulthood [36]. This
marker was not detected in MSCs or in pre-differentiated
MSCs, suggesting that these MSC-derived dopaminergic
neurons did not exhibit a complete midbrain identity.
However, neurogenesis in adult progenitors cannot be
fully compared with developmental neurogenesis for the
former is solely under environmental control whereas the
latter is coordinated by morphogenetic signaling mole-
cules produced by localized signaling centers [25].
Methods that combine chemicals with neurotrophic
factors have been reported to result in the expression of
neural markers, such as Tuj-1, GFAP, NSE, nestin, and
NF [38]. However, these treatments require long culture
times (3 - 14 d) or multistep differentiation protocols. In
the present study, cells incubated in our medium allowed
us to obtain immature dopaminergic cells in a short time
(48 h), representing an advantage for autologous or het-
erologous transplantation procedures in terms of elimi-
nating excessive manipulation of cells and prolonged
culture times.
5. CONCLUSION
Although further studies are needed to verify its full
efficacy in animal model, the results are encouraging for
the use of pre-differentiated MSCs, as a possible alterna-
tive for Parkinson’s disease cell therapy.
6. ACKNOWLEDGEMENTS
This work was partially funded by endowments from ITESM
(cat-134) and the Zambrano-Hellion Foundation. The funders had no
role in study design, data collection and analysis, decisi o n t o p u bl i s h , or
preparation of the manuscript. No additional external funding was
received for this study. The authors express their appreciation to Rosa
Maria de la Rosa for technical assistance.
REFERENCES
[1] Mizuno, Y., Hattori, N., Kubo, S., et al. (2008) Progress
in the pathogenesis and genetics of Parkinson’s disease.
Philosophical Transactions of the Royal Society B: Bio-
logical Sciences, 363, 2215-2227.
doi:10.1098/rstb.2008.2273
[2] Savitt, J.M., Dawson, V.L. and Dawson, T.M. (2006)
Diagnosis and treatment of Parkinson disease: Molecules
to medicine. Journal of Clinical Investigation, 116,
1744-1754. doi:10.1172/JCI29178
[3] Bjorklund, L.M., Sánchez-Pernaute, R., Chung, S., et al.
(2002) Embryonic stem cells develop into functional
dopaminergic neurons after transplantation in a Parkinson
rat model. Proceedings of the National Academy of Sci-
ences of the United States of America, 99, 2344-2349.
doi:10.1073/pnas.022438099
[4] Cho, Y.H., Kim, D.S., Kim, P.G., Hwang, et al. (2006)
Dopamine neurons derived from embryonic stem cells ef-
ficiently induce behavioral recovery in a Parkinsonian rat
model. Biochemical and Biophysical Research Commu-
nications, 341, 6-12. doi:10.1016/j.bbrc.2005.12.140
[5] Mine, Y., Hayashi, T., Yamada, M., Okano, H. and
Kawase, T. (2009) Environmental cue-dependent dopa-
minergic neuronal differentiation and functional effect of
grafted neuroepithelial stem cells in parkinsonian brain.
Neurosurgery, 65, 741-753.
doi:10.1227/01.NEU.0000351281.45986.76
[6] Ben-Hur, T., Idelson, M., Khaner, H., et al. (2004) Trans-
plantation of human embryonic stem cell-derived neural
progenitors improves behavioral deficit in Parkinsonian
rats. Stem Cells, 22, 1246-1255.
doi:10.1634/stemcells.2004-0094
[7] Freed, C.R., Greene, P.E., Breeze, R.E., et al. (2001)
Transplantation of embryonic dopamine neurons for se-
vere Parkinson’s disease. New England Journal of Medi-
cine, 344, 710-719. doi:10.1056/NEJM200103083441002
[8] Kordower, J.H., Freeman, T.B., Snow, B.J., et al. (1995)
Neuropathological evidence of graft survival and striatal
reinnervation after the transplantation of fetal mesence-
phalic tissue in a patient with Parkinson’s disease. New
England Journal of Medicine, 332, 1118-1124.
doi:10.1056/NEJM199504273321702
[9] Brundin, P., Pogarell, O., Hagell, P., et al. (2000) Bilateral
caudate and putamen grafts of embryonic mesencephalic
tissue treated with lazaroids in Parkinson’s disease. Brain,
123, 1380-1390. doi:10.1093/brain/123.7.1380
[10] Piccini, P., Pavese, N., Hagell, P., et al. (2005) Factors
affecting the clinical outcome after neural transplantation
in Parkinson’s disease. Brain, 128, 2977-2986.
doi:10.1093/brain/awh649
[11] Chu, Y., & Kordower, J.H. (2010) Lewy body pathology
in fetal grafts. Annals of the New York Academic of Sci-
ence, 1184, 55-67.
d oi:10.1111/j.1749-6632.2009.05229.x

J. Zavala-Arcos et al. / Stem Cell Discovery 3 (2013) 133-138
138
[12] Li, J.Y., Englund, E., Widner, H., et al. (2010) Charac-
terization of lewy body pathology in 12- and 16-year-old
intrastriatal mesencephalic grafts surviving in a patient
with Parkinson’s disease. Movement Disorder, 25, 1091-
1096. doi:10.1002/mds.23012
[13] Vierbuchen, T., Ostermeier, A., Pang, Z.P., Kokubu, Y.,
Südhof, T.C. and Wernig, M. (2010) Direct conversion of
fibroblasts to functional neurons by defined factors. Na-
ture, 463, 1035-1041. doi:10.1038/nature08797
[14] Pfisterer, U., Kirkeby, A., Torper, O., et al. (2011) Direct
conversion of human fibroblasts to dopaminergic neurons.
Proceedings of the National Academy of Sciences of the
United States of America, 108, 10343-10348.
doi:10.1073/pnas.1105135108
[15] Pang, Z.P., Yang, N., Vierbuchen, T., et al. (2011) In-
duction of human neuronal cells by defined transcription
factors. Nature, 476, 220-223. doi:10.1038/nature10202
[16] Blandini, F., Cova, L., Armentero, M.T., et al. (2010)
Transplantation of undifferentiated human mesenchymal
stem cells protects against 6-hydroxydopamine neurotox-
icity in the rat. Cell Transplantation, 19, 203-217.
doi:10.3727/096368909X479839
[17] Khoo, M.L., Tao, H., Meedeniya, A.C., Mackay-Sim, A.
and Ma, D.D. (2011) Transplantation of neuronal-primed
human bone marrow mesenchymal stem cells in hemi-
parkinsonian rodents. PLoS One, 6, e19025.
doi:10.1371/journal.pone.0019025
[18] Binato, R., de Souza Fernandez, T., Lazzarotto-Silva, C.,
et al. (2013) Stability of human mesenchymal stem cells
during in vitro culture: Considerations for cell therapy.
Cell Proliferation, 46, 10-22. d oi:10.1111/cpr. 1200 2
[19] Montzka, K., Lassonczyky, N., Tshöke, B., et al. (2009)
Neural differentiation potential of human bone marrow-
derived mesenchymal stromal cells. BMC Neuroscience,
10, 16. doi:10.1186/1471-2202-10-16
[20] Lu, P., Blesch, A. and Tuszynski, M. (2004) Induction of
bone marrow stromal cells to neurons: Differentiation,
transdifferentiation or artifact? Journal of Neuroscience
Research, 77, 174-191. doi:10.1002/jnr.20148
[21] Croft, A. and Przyborski, S. (1999) Formation of neurons
by non-neural adult stem cells: Potential mechanism im-
plicates an artifact of growth in culture. Stem Cells, 24,
1841-1851. doi:10.1634/stemcells.2005-0609
[22] Ren, X.D., Kiosses, W.B. and Schwartz, M.A. (1999)
Regulation of the small GTP binding protein Rho by cell
adhesion and the cytoskeleton. EMBO Journal, 18, 578-
585. doi:10.1093/emboj/18.3.578
[23] Yujiri, T., Fanger, G.R., Garrington, T.P., Schlesinger, T.K.,
Gibson, S. and Johnson, G.L. (1999) MEK kinase 1
(MEKK1) transduces c-Jun NH2-terminal kinase active-
tion in response to changes in the microtubule cytoskele-
ton. Journal of Biological Chemistry, 274, 12605-12610.
doi:10.1074/jbc.274.18.12605
[24] Subbaramaiah, K., Hart, J.C. and Norton, L. (2000) Dan-
nenberg AJ Microtubule-interfering agents stimulate the
transcription of cyclooxygenase-2. Evidence for in-
volvement of RK1/2 AND p38 mitogen-activated protein
kinase pathways. Journal of Biological Chemistry, 275,
14838-14845. doi:10.1074/jbc.275.20.14838
[25] Gale, E. and Li, M. (2008) Midbrain dopaminergic neu-
ron fate specification: Of mice and embryonic stem cells.
Molecular Brain, 1, 8. doi:10.1186/1756-6606-1-8
[26] Björklund, A. and Dunnett, S. (2007) Dopamine neuron
systems in the brain: An update. Trends in Neuroscience,
30, 194-202. doi:10.1016/j.tins.2007.03.006
[27] Hammond, R., Blaes, S. and Abeliovich, A. (2009) Sonic
hedgehog is a chemoattractant for midbrain dopaminergic
axons. PLoS One, 4, e7007.
doi:10.1371/journal.pone.0007007
[28] Hyman , C., Hofe r, M., Bar de, Y., et al. (1991) BDNF is a
neutrophic factor for dopaminergic neurons of the sub-
stantia nigra. Nature, 350, 230-232.
doi:10.1038/350230a0
[29] Volpicelli, F., Caiazzo, M., Greco, D., et al. (2007) BDNF
gene is a downstream target of Nurr1 transcription factor
in rat midbrain neurons in vitro. Journal of Neurochemis-
try, 102, 441-453.
d oi:10.1111/j.1471-4159.2007.04494.x
[30] Bang, A., Papalopulu, N., Kintner, C. and Goulding, M.
(1997) Expression of Pax3 is initiated in the early neural
plate by posteriorizing signals produced by the organizer
and by posterior non-axial mesoderm. Development, 124,
2075-2085.
[31] Goulding, M., Chalepakis, G., Deutsch, U., Erselius, J.R.
and Gruss, P. (1991) Pax3, a novel murine DNA-binding
protein expressed during early neurogenesis. EMBO
Journal, 10, 1135-1147.
[32] Daubner, S.C., Le, T. and Wang, S. (2011) Tyrosine hy-
droxylase and regulation of dopamine synthesis. Ar-
chieves of Biochemistry and Biophysics, 508, 1-12.
doi:10.1016/j.abb.2010.12.017
[33] Verhoeven, K., Jonghe, P., Putte, T., et al. (2003) Slowed
conduction and thin myelination of peripheral nerves as-
sociated with mutant Rho guanine-nucleotide exchange
factor 10. American Journal of Human Genetics, 73, 926-
932. doi:10.1086/378159
[34] Schmidt, A. and Hall, A. (2002) Guanine nucleotide ex-
change factors for Rho GTPases: Turning on the switch.
Genes and development, 16, 1587-1609.
doi:10.1101/gad.1003302
[35] Michalczyk, K. and Ziman, M. (2005) Nestin structure
and predicted function in cellular cytoskeletal organisa-
tion. Histology and histopathology, 20, 665-671.
[36] Canola, K., Angenieux, B., Tekaya, M., et al. (2007)
Retinal stem cells transplanted into models of late stages
of retinitis pigmentosa preferentially adopt a glial or a
retinal ganglion cell fate. Investigative ophthalmology
and visual science, 48, 446-454.
doi:10.1167/iovs.06-0190
[37] MacLaren, R.E., Pearson, R.A., MacNeil, A. et al. (2006)
Retinal repair by transplantation of photoreceptor pre-
cursors. Nature, 444, 203-207. doi:10.1038/nature05161
[38] Sanchez-Ramos, J., Song, S., Cardozo-Pelaez, F., et al.
(2000) Adult bone marrow stromal cells differentiate into
neural cells in vitro. Experimental Neurology, 164, 247-
256. doi:10.1006/exnr.2000.7389