Chimeric oncogenic interferon regulatory factor-2 (IRF-2): Degradation products are biologically active ()
1. INTRODUCTION
IRF-2 is a transcription regulator of virusand IFNinduced signalling pathways, which plays a critical role in antiviral defence, immune response, cell growth regulation and oncogenesis [1]. IRF-2 belongs to IRF family whose ten members are known so far. They are namely IRF-1, IRF-2, IRF-3, IRF-4 (Pip/PU.1/LSIRF/ICSAT), IRF-5, IRF-6, IRF-7, IRF-8 (ICSBP), IRF-9 (P48/ISGF- 3g). All members having pentad tryptophan in their DNA binding Domain (DBD) present at N-terminus of the protein. The diversity in function(s) among family members are due to presence of diverse C-terminus, for instance, IRF-1, IRF-3, IRF-7, IRF-9 and IRF-10 is transcriptional activator whereas IRF-2 and IRF-8 is transcriptional repressor/activator [1].
Mutational analysis has shown that IRF-2 protein has N-terminal DNA binding domain (DBD) and C-terminal Repression domain (RD) [2]. A variety of agents like type-1-IFN, IRF-1, viruses, dsRNA and other agents stimulate IRF-2 mRNA expression [2]. IRF-2 participates in regulation of IFN signaling by binding on ISRE (IFN Stimulated Response Element) sequence. IRF-2 attenuates IRF-1-mediated gene expression by competitively binding on interferon stimulated response element (ISRE) sequence of the gene [3]. Moreover, IRF-2 regulates cell cycle progression by inducing expression of H4 gene [4]. Thus, IRF-2 is a very important transcription factor, having both repression as well as activation function. IRF-2 DNA binding domain is almost similar to DBD of rest of the members and regulates repression as well as activation. Thus, binding pattern of IRF-2 is crucial for its functions. The carboxyl terminus of IRF-2 contains a repression domain, the deletion of which converts IRF-2 to a transcriptional activator [5]. With regard to the regulatory modifications of IRF-2 proteins, it undergoes inducible proteolytic processing. IRF-2 is cleaved in carboxyl terminal region following viral infection or double-stranded RNA treatment, resulting in its conversion to either an activator or a strong repressor [6].
Several studies have suggested that IRF-2 is oncogenic in nature. IRF-2 causes cancer when abnormally over expressed or mutated. In Pancreatic tumor, this gene is found to be over expressed [7]. Apart that, in vivo study from pancreatic tumour samples showed that IRF-2 gene is point mutated lead to inactivation of this gene product [8]. Although the exact mechanism underlying this cell transformation is still unknown, it is possible that IRF-2 exerts its oncogenic function through mediation of IRF-1 and/or other IRF family members. This possibility supported by the finding that NIH 3T3 cells expressing only the DBD of IRF-2 were also transformed. On the other hand, alteration of IRF-1/2 expression may occur in breast cancer tissues [9]. Moreover, IRF-2 makes the cancerous esophageal cells refractory to INFg action via suppressing IFNGR1 in order to develop cancer. In this condition, IRF-2 level goes up that down regulate the IFNGR1 expression and makes esophageal cancer cells resistance to antitumour cytokine IFNg [10]. This supports the conclusion that IRF-2 is an oncogene.
In the present study, we have done molecular subcloning and expression of recombinant IRF-2 as a GST (Glutathione-S-Transferase)-IRF-2 fusion protein. We demonstrated four different lower molecular mass degradation products along with full length recombinant protein. Furthermore, we have shown that degradation took place at C-terminus. These degradation products are capable for bind with VREβ and IRF-E motif. This means degradation products are biologically active in terms of DNA binding and may influence the target gene(s) expression.
2. MATERIALS AND METHODS
2.1. Plasmids, Escherichia coli Cells, Antibodies and Reagents
Mouse IRF-2 cDNA (pIRF2.5 Plasmid), pGEM®-T Vector Systems (Promega), pGEX2TK expression plasmid, E. coli DH5α- and XL-1Blue cells for IRF-2 sub-cloning and expression, respectively, forward primer (IRF-2P1: 5’AAGGATCCATGCCGGTGGAACGGATGCGA 3’) and reverse primer (IRF-2P2: 5’AAGGATCCTTAACAGCTCTTGACACGGGC 3’), anti-GST (G7781, Sigma-aldrich, USA) and anti-rabbit IgG-HRP antibodies (A9169, Sigma-aldrich, USA), antiIRF-2 antibody (H-229: sc-13042, Santa Cruz Biotech, USA), Taq DNA polymerase (Stratagene), restriction enzymes, T4 DNA ligase and T4 polynucleotide kinase (New England Biolabs, MBI Fermentas) and molecular biology grade reagents (Sigma Chemicals Co.). The most commonly used molecular biology methods were adopted from the reference [11] and suitably modified.
2.2. TA-Cloning and Sequencing
The PCR products were separated on a 1% agaroseethidium bromide gel, cut out from the gel and purified (Gel Extraction Kit, Qiagen). Two microliters of purified PCR product (~25 ng) was ligated into pGEM-T easy vector (Promega) in the following mix: 2 µl of gel purified IRF-2 ORF, 2 µl pGEMT easy vector (25 ng/µl), 1 µl T4 DNA Ligase (3U/µl), 5 µl ligation buffer (2X) (30 mM Tris-HCl pH 7.8, 10 mM MgCl2, 10 mM DTT, 10 mM ATP, 5% polyethylene glycol). Four microlitres of a ligation mix were added to 200 µl of E. coli/DH5α competent cells and plated onto 100 µg/ml ampicillin containing LB agar plates. White colonies were picked and checked for the presence of the insert by PCR. PCR-positive colonies were grown overnight in 5 ml of 100 µl/ml ampicillin containing LB medium. Plasmids were extracted from bacteria, purified (Miniprep purification Kit, Qiagen) and its insert sequenced commercially on an ABI 377 Automated Sequencer (TCGA, New Delhi) using M13 reverse and forward primers. Chromatograms were then analysed with Chromas software.
2.3. pGEX-2TK Cloning
The IRF-2 ORF fragment was sub-cloned into pGEX2TK vector at BamHI site after digesting pGEMT-IRF-2 clone with BamHI restriction endonuclease followed by gel purification. Ligation reaction was set up as follows: 5 µl IRF-2 ORF gel purified insert (~ 50 ng), 7 µl pGEX2TK vector (150 ng) BamHI digested, dephosphorylated and gel purified, 1 µl of T4 DNA Ligase (NEB) (400 U/µl), 3 µl ligation buffer (5X) (30 mM Tris-HCl pH 7.8, 10 mM MgCl2, 10 mM DTT, 200 mM ATP, 5% polyethylene glycol). Four microliters of a ligation mix were added to 200 µl of E. coli/ XL-1 blue competent cells and plated onto 100 µl/ ml Ampicillin Containing LB agar plates. Colonies were picked and checked for the presence of the insert by BamHI Restriction digestion.
2.4. Expression of GST-IRF-2
Five milliliter LB medium containing ampicillin (100 mg/ml) was inoculated with a single colony of pGEXIRF-2 /E. coli XL-1 and grown overnight at 37˚C. 100 ml of the overnight grown culture was used to inoculate another 10 ml LB with appropriate ampicillin and grown for 3 - 4 hours at 37˚C until O.D600 nm reached between 0.6 to 0.8. IPTG (0.5 mM) induction was carried out at 37˚C for 3 hours along with the control (E. coli XL-1 blue cells containing pGEX-2TK vector). Extracts from the equal number of cells (~1.0 O.D600 nm) was prepared and used to assess GST-IRF-2 expression. Cell pellet from 1.0 O.D. volume of each culture was resuspended in 150 ml of water and 50 ml of 4X loading dye (0.06 M Tris Cl, pH.8.0, 2% SDS, 10% Glycerol, 0.025% Bromophenol blue) and subjected to boil in a water bath at 95˚C for 10 minutes. The samples were given a spin at 10 K rpm, RT for 30 seconds and resolved in 10% SDS-PAGE at 100 V for 6 hrs. The gel was stained with Coomassie brilliant blue R250.
2.5. Western Immunoblotting
IPTG-induced and uninduced E. coli/XL-1blue cells expressing recombinant IRF-2 cell extracts were resolved on 10% SDS-PAGE, electroblot to nitro-cellulose filters, blocked by 5% milk in PBST (PBS with Tween-20), washed by PBST and incubated with anti-GST (1:2000) antibody, washed by PBST, further incubated with antirabbit IgG-HRP secondary antibody (1:3000), washed by PBST and developed by DAB (3,3’-diaminobenzidine)- staining.
2.6. E. coli Extract for EMSA
Fifty milliliter of the IPTG-induced culture were centrifuged at 5 k rpm for 5 minutes at 4˚C. The cell pellet was washed with 5 ml PBS and resuspended in 5 ml of lysis buffer (10 mM HEPES, pH 7.9; 2 mM EDTA, pH 8.0; 1 mM EGTA 400 mM KCl; 0.1% Triton X-100; 10% glycerol; 1 mM DTT; 1 mM PMSF and 1mg/ml of the protease inhibitors: Aprotinin, Leupeptin and Benzamidine), sonicated on ice at 15 micron amplitude for 15 seconds, repeated six times with intervals of one minute. The extract was clarified by centrifugation at 12 krpm for 5 minutes at 4˚C. The supernatant was aliquoted and stored at –80˚C for further use. Protein concentration of the extract was estimated by Bradford’s reagent.
2.7. Electrophoretic Mobility Shift Assay
One picomole of (GAAAGT)4 and VREβ
(5’-GGGAGAAGTGAAAGGGGGAAATTCCTCTGA ATAGAGAGAGGAC-3’) oligonucleotides were
32P-labeled at the 5’ end by using g [32P] ATP and T4 polynucleotide kinase; the labeled oligonucleotide was separated from the free label by Sephadex G-50 spin column. The 32P-labeled oligonucleotide was annealed into the double-stranded oligonucleotide by mixing it with nine pmol of the complementary oligonucleotide. A typical DNA binding reaction contained 2.0 mg of bacterial cell extract, 50 fmol of double stranded 32P(GAAAGT)4 or 32PVREβ (specific activity: 2 – 3 × 106 cpm/pmol) in the reaction buffer (20 mM HEPES, pH 7.9, 0.4 mM EDTA, pH 8.0, 0.4 mM DTT, 5% glycerol) containing 2.0 mg of calf thymus DNA and was incubated at 37˚C for 30 minutes. In cold-competition assay 100 X-fold molar excess of the double stranded (GAAAGT)4 competitors was added in addition. The sample was mixed with loading dye and resolved in 7.5% native polyacrylamide gel ran at 150 V for four hours. The gel was dried on 3-mm filter paper at 80˚C for 1 h, exposed to the phosphor screen and the image was developed in a fujifilm FLA 5000 phosphoimager and pixels per DNAprotein complex and free label were quantitated from the primary TIFF-image by image gauge V2.54 software.
3. RESULTS
3.1. Amplification of IRF-2 ORF by PCR and Construction of pGEMT-IRF-2 Clones
Figure 1(a) shows the 1047 bp IRF-2 ORF (atg to tag) was PCR amplified from IRF-2 cDNA containing plasmid pIRF2.5 by using forward primer (IRF-2P1) and reverse primer (IRF-2P2) primers. The IRF-2 ORF amplicon was sub-cloned into the multiple cloning site of pGEMT vector (T-A cloning). Figure 1(b) shows map of pGEMTIRF-2 vector showing arrangement of IRF-2 ORF. Furthermore, recombinancy of pGEMT-IRF-2 vector was confirmed by BamHI restriction digestion. Figure 1(c) shows release of IRF-2 fragment (~1 kbp) after BamHI digestion (lanes 5 and 7). On that basis, two clones namely, pGEMT-IRF-2 (2.2 and 2.3) were selected for subsequent work.