Cassava mosaic disease caused by the whitefly-transmitted begomoviruses (family Geminiviridae) is a major threat to cassava ( Manihot esculenta Crantz) production, which can be intercropped with other plants such as pepper ( Capsicum annuum L.). The aim of this study is to identify cassava begomoviruses on other crops in cassava intercropping systems. Thus, foliar samples showing typical symptoms of virus diseases in cassava intercropping systems were collected from pepper and submitted to PCR analysis and direct sequencing. Three begomovirus species ACMV, EACMV and ALCCMV were identified and characterized in samples. Isolates of these species shared respectively 90% - 93%, 74% and 80% nucleotide identities with begomoviruses. These findings show that cassava begomoviruses can infect other crops and will help in understanding the epidemiology related to whitefly-transmitted begomoviruses in cassava intercropping systems.
The most damaging and economically important diseases of crops, especially in tropical and subtropical regions are caused by the whitefly-transmitted begomoviruses. These viruses are included in the genus Begomovirus of the family Geminiviridae and are responsible for causing crop losses ranging from 30% to 100% [
Cassava mosaic disease (CMD) caused by whitefly-transmitted begomoviruses is the main factor of cassava (Manihot esculenta Crantz) decrease yields [
This study was initiated to identify cassava begomoviruses on other crops in cassava intercropping systems. Results of this study will help to better understand the disease epidemics, related to whitefly-transmitted begomoviruses as well as Bemisia tabaci biotypes behavior within these systems.
Foliar samples from pepper plants intercropped with cassava showing typical symptoms of viral diseases (mosaic, distortion, leaf curling, yellowing and deformation) were collected through the five economic regions of Togo.
Total DNA was extracted from collected leaves using the DNA minipreparation method [
Detection of cassava mosaic begomoviruses (CMBs) in samples was performed by PCR amplification using three sets of specific primers targeting the coat protein (
Primer | Sequence 5’……………………….…3’ | Size (bp) | Reference |
---|---|---|---|
JSP001 | ATGTCGAAGCGACCAGGAGAT | 770 | [ |
JSP002 | TGTTTATTAATTGCCAATACT | ||
JSP003 | CCTTTATTAATTTGTCACTGC | ||
JSP012 | GTCCATATAGGTAARGTNATG | ||
JSP013 | CCTGCTCCTTGCTNGCYTART | ||
AC 1048 | GGRTTDGARGCATGHGTACATG | 560 | [ |
AV 494 | GCCYATRTAYAGRAAGCCMAG |
D = A, G, T; H = A, C, T; K = G, T; M = A, C; N = A, C, G, T; R = A, G; W = A, T; Y = C, T.
The PCR thermal profile for CMBs was as followed: a 94˚C denaturation step of 2 min followed by 30 cycles of denaturing at 94˚C for 30 secs, annealing at (50˚C for ACMV and EACMV and 52˚C for ICMV) for 30 secs and extension at 72˚C for 1 min and then a final extension step at 72˚C for 10 min [
PCR amplified products were resolved by agarose gel electrophoresis and visualized under ultraviolet (UV) light using Gel Doc 2000 (Bio-Rad, Hercules, CA, USA). A 100 bp DNA molecular weight marker (Smart ladder small fragments Eurogentec) was run in each gel as a reference to estimate the size of the virus-specific DNA band in the PCR amplified products.
Illumina Nextera XT Index kit (Illumina Inc., San Diego, CA, USA) was used according to the manufacturer’s instructions to assign a code to each sample before the sequencing. Purity of the PCR products was verified with the Agilent Bioanalyzer 2100 (Agilent Technologies, Palo Alto, CA, USA) and the sequencing was performed at the UPJV Molecular Biology platform based on “Sequencing by Synthesis” technology. Illumina Miseq Reagent Kit V2 (Illumina Inc., San Diego, CA, USA) was used to perform this sequencing.
BLASTn program (http://blast.ncbi.nlm.nih.gov/Blast.cgi) was used for preliminary analysis [
Phylogenetic analysis was performed by Neighbor-Joining method using Darwin6. A thousand bootstrap replications, was used to evaluate the robustness of each individual branch. Tree was visualized and edited using Darwin6.
The nucleotide sequences of the following begomovirus (GenBank accession numbers are given) were included in the analysis: African cassava mosaic virus (AF259894.1, AY562423.1, EU685318.1, FM877473.1, HE979761.1, HG530111.1, KJ887779.1, KR476371.1, KR476372.1); East African cassava mosaic virus (AJ717553.1, HG530116.1); East African cassava mosaic Cameroon virus (AF112354.1, KJ887944.1); East African cassava mosaic Kenya virus (JF909078.1, KJ888087.1); East African cassava mosaic virus-Tanzania (Z82356.1); East African cassava mosaic virus-Uganda (KT780440.1); Ageratum leaf curl Cameroon virus (FR717144.1, FR873228.1, FR873230.1); Pepper yellow vein Mali virus (KY271076.1, FM876851.1, AM691555.1, AY502935.1) and Pepper golden mosaic virus (EF027236.1).
A total of nineteen samples were collected (
PCR products with the expected size were amplified from collected samples with primers JSP001/JSP003 and AC1048/AV494 confirming the association of begomovirus with symptoms. This indicates in addition, that pepper is natural infected by East African cassava mosaic virus (EACMV). Based on PCR results with primers JSP001/JSP003 and AC1048/AV494, 10.53% and 26.31% of samples were respectively infected (
PCR products were submitted to direct sequencing. Three sequences obtained from these products were selected for phylogenetic and pairwise nucleotide analysis
Region | Locality | Sample number | Samples reaction to PCR | |||
---|---|---|---|---|---|---|
JSP001/ JSP002 | JSP001/ JSP003 | JSP012/ JSP013 | AC1048/ AV494 | |||
Maritime | Lome | 1 | - | - | - | + |
Maritime | Alokoegbe | 1 | - | + | - | - |
Maritime | Gblainvie | 1 | - | - | - | - |
Maritime | Alokoegbe | 1 | - | - | - | - |
Maritime | Blama Kondji | 1 | - | + (Isolate B51) | - | + |
Maritime | Blama Kondji | 1 | - | - | - | - |
Maritime | Game | 1 | - | - | - | - |
Plateaus | Tikoe/Agou Agotime | 1 | - | - | - | - |
Plateaus | Tikoe/Agou Agotime | 1 | - | - | - | - |
Plateaus | Koudravi | 1 | - | - | - | - |
Plateaus | Tokudjahoui | 1 | - | - | - | - |
Plateaus | Tokudjahoui | 1 | - | - | - | + |
Plateaus | Houdje | 1 | - | - | - | - |
Plateaus | Kougnonhou | 1 | - | - | - | + |
Plateaus | Amouka | 1 | - | - | - | - |
Plateaus | Kessibo/Dandjodji | 1 | - | - | - | - |
Savannah | Nabou (Biangou) | 1 | - | - | - | - |
Savannah | Kambere | 1 | - | - | - | + (Isolates G44a and G44b) |
Central | Bowou Kope | 1 | - | - | - | - |
Incidence (%) | 0 | 10.53 | 0 | 26.31 |
- = Sample reacted negatively to PCR; + = Samples reacted positively to PCR.
(
Sequence comparisons revealed that isolate B51 from primers JSP001/JSP003 specifics to East African cassava mosaic virus (EACMV), shared the highest sequence identity (74%) with EACMV AJ717553.1; but also, with African cassava mosaic virus (ACMV) KJ887779.1 and Pepper yellow vein Mali virus (PepYVMV) isolates AM691555.1, AY502935.1 and KY271076.1 (
Isolates G44a and G44b from primers AC1048/AV494 shared high level of nucleotides identity respectively with Ageratum leaf curl Cameroon virus (ALCCMV) isolate FR873230.1 (80%) and ACMV AF259894.1 (93%). Isolate
G44b also shared 90% identity with EAMCV references (HG530116.1 and KT780440.1) (
This study has demonstrated three unknown infections of begomovirus in pepper foliar samples including Ageratum leaf curl Cameroon virus (ALCCMV), a new strain of East African cassava mosaic virus (EACMV) and a recombinant of African cassava mosaic virus (ACMV) and EACMV.
Diagnosis of cassava mosaic begomoviruses (ACMV and EACMV) in pepper showed that these begomoviruses could infect other crop species than cassava. This is the first identification and characterization of begomoviruses responsible of cassava mosaic disease in another cultivated plant in Togo. The ability of begomoviruses to infect plants belonging to different taxonomic families has been studied. Indeed, Tomato yellow spot virus (ToYSV) can infect tomato (Solanaceae) and soybean (Fabaceae); likewise, Tomato leaf curl New Delhi virus (ToLCNDV) infects Solanaceae and Cucurbitaceae [
It is known that genomic plasticity of begomoviruses allows them to adapt to new environments and hosts [
A general consensus exists that Bemisia tabaci is a complex of morphologically indistinguishable populations with different biological biotypes. The cassava biotype of Bemisia tabaci is known to colonize only cassava and wild eggplant whereas the sweet potato biotype colonizes various plant and weed species but not cassava [
In cassava intercropping systems, these intermediate hosts or plants belonging to the same family are used as secondary crops associated with cassava and weeds can belong to Fabaceae and Euphorbiaceae families. [
Ageratum leaf curl Cameroon virus was first identified on Ageratum conyzoïdes (L.) in Cameroon [
Occurrence of new begomovirus species on pepper could lead in case of mixed infections with already known begomoviruses infecting this crop to recombinant actions [
This study showed that cassava mosaic begomoviruses could infect other cultivated plants than cassava and suggested a change in Bemisia tabaci population or in its feed habit. Further investigations will bring more information about cassava mosaic begomoviruses and pepper relationships.
This work was supported by International Foundation of Science (IFS) research grant C/5596-1 to K.A. Dansou-Kodjo; and by West African Virus Epidemiology for Togo (WAVE-UL) project.
The authors declare no conflicts of interest regarding the publication of this paper.
Dansou-Kodjo, K.A., Mivedor, A.S., Adjata, K.D., Duclercq, J. and Gumedzoe, Y.M.D. (2019) Occurrence of Cassava Mosaic Begomovirus New Species and Ageratum Leaf Curl Cameroon Virus on Pepper (Capsicum annuum L.) in Togo. Agricultural Sciences, 10, 671-682. https://doi.org/10.4236/as.2019.105052