Shrimp waste contains 20% - 60% chitin and possible to be source of chitinolytic bacteria. Chitinolytic bacteria are capable of hydrolyzing of chitin progressively to produce N-acetylglucosamine monomer which can be used to overcome the shrimp waste . The objectives of this research were to identify species of bacteria with high activity of chitin degradation in shrimp waste and to analyze their potency as chitin degradation agent. The research consists of screening of chitinolytic bacteria based on chitinolytic inde x, activity assay of chitinase using colorimetric method , and molecular identif ication of bacteria based on 16S rDNA sequences. Two of eighteen isolates of chitinolytic bacteria (PBK 2 and SA 1.2 isolates) showed the highest chitinolytic index, which were 2.069 and 2.084, whereas chitinase activity was 0.213 and 0.219 U/ml respectively . Based on 16S rDNA sequences, isolate of PBK 2 was identified as Acinetobacter johnsonii 3-1, whereas SA 1.2 was identified as Bacillus amyloliquefaciens GR53 with 99.78% similarity .
Shrimp is one of the important export commodities of Indonesian fishery; therefore many fishery industries provide processed shrimp products to be exported [
Chitin (C6H9O4∙NHCOCH)n is linier homopolysaccharide which consists of 2000 - 3000 monomers of β-1,4 linked N-acetyl-D-glucosamine). It is second-most abundant organic compound after cellulose [
Colloidal chitin was prepared according modified method as described by Faramarzi et al. [
Solid waste (shrimp-shells) and shrimp wastewater aseptically collected from PT. Bumi Menara Internusa (08˚13'03.08''S, 112˚44'49.1''E). Chitinolytic bacteria were isolated using spread plate method in CCA medium (Colloidal Chitin Agar) which consist of (g/L): Na2HPO4 (6); KH2PO4 (3); NH4Cl (1); NaCl (0.5); yeast extract (0.05); agar (15) and colloidal chitin 0.5% (w/v). Chitinolytic bacteria showed by clear zones surrounding colonies after 72 h of incubations at 30˚C [
Primary screening was performed by disc diffusion modified method of Jiang [
Chitinase activity was determined using colorimetric method as described by Monreal and Reese [
Two loopfull of chitinolytic bacteria was inoculated in Luria Bertani broth (Merck) and incubated for 24 hours, 120 rpm, 30˚C. Whole genome extraction was carried out by Ausubel method [
Sequences of 16S rDNA was amplified with universal primers 27F (5’GAGAGTTTGATCCTGGCTCAG3’) and 1492R (5’CTACGGCTACCTTGTTACGA3’) [
Sequences of 16S rDNA was matched with sequences of reference strains (
Eighteen isolates with different morphology of colonies were isolated from shrimp waste, 14 isolates from wastewater, and 4 isolates from shrimp-shells waste. Wastewater aeration can support more bacterial growth. During aeration, bacteria will grow and survive by using oxygen to breakdown wastewater compound and combine with organic matter in wastewater to form an activated sludge [
As shown in
Composition | Volume (µl) | Concentration |
---|---|---|
ddH2O | 6 | - |
2x PCR Master Mix (i-Taq™) | 15 | - |
Primer 1 (27f) | 3 | 10 pmol/µl |
Primer 2 (1495r) | 3 | 10 pmol/µl |
DNA template | 3 | 1 µg |
Reaction | Temperature (˚C) | Time (minutes) |
---|---|---|
Pre-denaturation | 94 | 5 |
35 cycles : denaturation | 94 | 0.5 |
Annealing | 55 | 0.5 |
Extension | 72 | 1.5 |
Post extension | 72 | 5 |
No. | Acession number | Species | Strain |
---|---|---|---|
1 | EU594557 | Acinetobacter johnsonii | 3-1 |
2 | JQ039983 | Acinetobacter johnsonii | YNB71 |
3 | EU730929 | Acinetobacter johnsonii | 178 |
4 | KJ569367 | Acinetobacter schindleri | C47EM |
5 | KJ569366 | Acinetobacter schindleri | EM21 |
6 | NR025412 | Acinetobacter schindleri | LUH5832T |
7 | AB859678 | Acinetobacter schindleri | MTCC 9827 |
8 | FJ373024 | Acinetobacter schindleri | W1-2 |
9 | JX315564 | Acinetobacter schindleri | URT27 |
10 | HQ689693 | Acinetobacter schindleri | IBP-SL13 |
11 | Z93438 | Acinetobacter junii | ATCC 17908T |
12 | Z93434 | Acinetobacter calcoaceticus | ATCC 23055T |
13 | EF423606 | Bacillus amyloliquefaciens | ATCC 15841 |
14 | EF423604 | Bacillus amyloliquefaciens | ATCC 21556 |
15 | EF423607 | Bacillus amyloliquefaciens | ATCC 21770 |
16 | NR118950 | Bacillus amyloliquefaciens | ATCC 23350 T |
17 | DQ993675 | Bacillus amyloliquefaciens | ATCC 49763 |
18 | EF423605 | Bacillus amyloliquefaciens | BCRC 11266 |
19 | EF433406 | Bacillus amyloliquefaciens | BCRC 11601T |
20 | KJ937782 | Bacillus amyloliquefaciens | GR53 |
21 | KC692168 | Bacillus amyloliquefaciens | ML265 |
22 | AB679995 | Bacillus amyloliquefaciens | NBRC 3037 |
23 | NR114581 | Bacillus thuringiensis | ATCC 10792T |
Chitin is substrate which can induce exochitinase and endochitinase formation in microorganisms [
Chitinase activity of microorganisms is different from each other depends on various factors such as time of enzymatic reaction, enzyme and substrate concentation, incubation time, and pH of medium [
Amplicon 16S rDNA sequences of isolate PBK 2 and SA 1.2 on 1% agarose gels showed in 1500 bp (
Genus Acinetobacter and Bacillus were dominant bacteria in industrial wastewater especially in activated sludge flocs which involved in denitrification process with other genus such as Pseudomonas, Spirillum, Hyphomicrobium, Agrobacterium, Propionibacterium, Rhizobium, Corynebacterium, Cytophaga, Thiobacillus, and Alcaligenes [
As shown in
to produce chitinase. According to Wang et al. [
Two of eighteen isolates of chitinolytic bacteria (PBK 2 and SA 1.2 isolates) showed the highest chitinolytic index, which were 2.069 and 2.084, whereas chitinase activity was 0.213 and 0.219 U/ml respectively. Based on 16S rDNA sequences, isolate of PBK 2 was identified as Acinetobacter johnsonii 3-1 with 99.78% similarity, whereas SA 1.2 was identified as Bacillus amyloliquefaciens GR53 with 99.78% similarity.
Imanda N.Setia,Suharjono , (2015) Chitinolytic Assay and Identification of Bacteria Isolated from Shrimp Waste Based on 16S rDNA Sequences. Advances in Microbiology,05,541-548. doi: 10.4236/aim.2015.57056