Detection of Adenovirus in Fresh Fruit, Vegetables, Wastewater and Manure from Irrigated Farms in Ouagadougou, Burkina Faso

Abstract

Enteric viral pathogens are responsible for numerous epidemics associated with the consumption of fresh fruit and vegetable, whether raw or minimally processed. The aim of the present study was to assess agricultural practices and the presence of adenovirus (AdV) in fruits and vegetables, manure and irrigation wastewater sampled in the urban and peri-urban perimeters of Ouagadougou. A total of 286 samples including 30 lettuces, 42 tomatoes, 30 carrots, 30 strawberries, 74 manures and 80 wastewater samples were collected from four market garden sites in and around Ouagadougou. Nested PCR was performed with specific primers to detect adenoviruses (AdVs). A face-to-face survey was carried out using a questionnaire on market garden production practices. Overall, adenoviruses prevalence was 5.9% [IC95, 3.2% - 8.7%] in all samples analyzed. It was specifically 7.14% (3/42) from tomatoes, 6.7% (2/30) from lettuces, 20% (6/30) on strawberries and 7.5% (6/80) in irrigation water. The survey showed that irrigation water came from untreated sources (dam, well, canal) and then 52% of farms used untreated manure. No farms have implemented measures to limit access by domestic and wild animals. This work shows the presence of human adenoviruses in surface irrigation water and fresh produce, which is of concern when fresh produce is consumed raw. To reduce the public health risks associated with consuming these foods, it is essential to follow good hygiene and cultivation practices.

Share and Cite:

Traore, K. , Sanou, M. , Ouoba, J. , Ouoba, B. , Roques, P. and Barro, N. (2024) Detection of Adenovirus in Fresh Fruit, Vegetables, Wastewater and Manure from Irrigated Farms in Ouagadougou, Burkina Faso. Food and Nutrition Sciences, 15, 644-662. doi: 10.4236/fns.2024.157041.

1. Introduction

Market gardening is a highly specialized form of agriculture [1]. This sector provides fruits and vegetables that are most often produced during the dry season. Fruits and vegetables offer multiple health benefits. They boost the immune system, combat malnutrition and prevent non-communicable diseases [2]. Fruit and vegetable production provides livelihoods and food for millions of people [1]. It contributes to a better quality of life for family farmers and their communities and strengthens resilience [3]. However, fruits and vegetables that are mainly eaten raw can be sources of enteric pathogens [4]. Indeed, the WHO [5] estimates that every year, approximately 600 million illnesses are foodborne, and 420,000 people die worldwide as a result. These diseases are often associated with two main food groups: fruits and vegetables and animal products [2]. Several types of enteric viruses, such as hepatitis A virus, hepatitis E virus, adenovirus, norovirus and rotavirus, have been detected in raw fruits [6]-[9] and vegetables and are potentially implicated in foodborne epidemics [10].

Human adenoviruses (HAdVs) are agents of gastroenteritis and represent the third most common cause of childhood diarrhea. HAdV belongs to the family Adenoviridae and the genus Mastadenovirus [11]. HAdV was first isolated from human adenoidal tissue and is characterized as a non-enveloped, non-segmented, and double-stranded DNA virus with a genome length of 3.4 - 3.6 kb that encodes three major capsid proteins, namely, hexon, penton base and fiber [12] [13]. To date, 113 types of HAdVs have been identified and classified into seven species (A - G) [14], of which species B, C, and E are highly contagious and are responsible for severe respiratory disease. In Burkina Faso, adenovirus types 40/41 (species F) were detected in 5% of diarrhea cases in children under 5 years of age [15]. In 2016, Ouédraogo et al. [16] reported a prevalence of 31.2% for adenoviruses, including 10.2% and 5.1% for HAdV types 40 and 41, respectively, in children in the same country. Adenovirus infections occur without seasonality in patients of all ages [17] [18] and susceptible populations, including children, military recruits and immunocompromised patients [19]. Type 40/41 viruses are transmitted via the fecal-oral route and are highly excreted in feces [20]. Studies have reported significantly high concentrations and seasonal variability of these viruses in various types of water worldwide, such as wastewater, surface water, seawater, freshwater, and treated and disinfected drinking water [21]-[24]. HAdV has also been proposed as an indicator of fecal contamination and water purification efficiency [25]-[27], reinforcing its potential as a foodborne virus. Adenovirus contamination of fruits and vegetables can occur mainly through irrigation water, natural fertilizers, infected food handlers or the use of contaminated equipment at some point in the food production chain. In Burkina Faso, wastewater and manure are widely used at fruit and vegetable production sites. However, very little data are available on the environmental prevalence of adenovirus. This study was designed to investigate the presence of human adenoviruses in the irrigation water-manure-vegetable continuum. Thus, the aim of the present study was to assess agricultural practices and the presence of adenoviruses in fresh products in the urban and peri-urban perimeters of Ouagadougou and establish whether the wastewater used for irrigation and manure is a potential source of fresh produce contamination.

2. Materials and Methods

2.1. Sites and Samples

This prospective study was conducted from September 2021 to July 2022. Samples were collected at four market garden production sites (Boulmiougou, Loumbila, Silmandé, and Tanghin) (Figure 1). These sites were chosen on the basis of fruit and vegetable availability, market garden production intensity and geographical location. A total of 74 samples of manure were used for spreading, 80 samples of surface water and 132 fresh produce products (tomato (Solanum lycopersicum L.), strawberry (Fragaria sp.), carrot (Daucus carota) and lettuce (Lactuca sativa)) irrigated with this water were collected in three urban areas and one peri-urban area of Ouagadougou.

Figure 1. Geographical distribution of sampled market gardening sites. Legend: (a) Market gardening sites in Tanghin and Silmandé; (b) Market gardening sites in Boulmiougou; (c) Market gardening sites in Loumbila.

2.2. Sampling Strategy and Surveys

Only ripe vegetables ready for sale or consumption were sampled. Tomatoes and strawberries with visible damage and/or cracks were not sampled. Each lettuce sample consisted of three plants. Similarly, a sample of tomatoes, strawberries or carrots comprised three tomatoes, three strawberries and three carrots, respectively, taken from different parts of the same field.

A 300 ml sample of irrigation water was taken from the retention basins (wells, dams, canals). Approximately 3 g of manure was collected from the manure sample in a sterile plastic tube.

A questionnaire survey was carried out on market garden farms to assess good agricultural practices (GAPs) and good hygienic practices (GHPs) (Appendix). The survey consisted of field observations and face-to-face interviews with 300 randomly selected market gardeners. Particular attention was given to the irrigation water used per site, human and animal activity and manure handling.

2.3. Preparation of Water Samples

The samples were processed using a method adapted from Ahmad et al. [28]. Water samples were divided into aliquots of 40 ml, and 0.25 ml of 50% (w/v) polyethylene glycol 8000/1.5 M NaCl was added to each sample (pH adjusted at 7 - 7.5) to reach a final concentration of 10% (w/v) PEG 8000 with sodium chloride to a final concentration of 0.4 M. This mixture was stirred at room temperature for 3 h and then centrifuged at 10,000×g for 90 min. The resulting pellet was suspended in 500 mL of 0.15 M phosphate buffer and stored at −20˚C.

2.4. Preparation of Fresh Produce Samples

Vegetable samples were processed using a method adapted from Coudray-Meunier et al. [29]. Fresh produce (25 g) in small pieces was mixed with 40 ml of Tris-glycine buffer (100 mM Tris-HCl, 50 mM glycine, and 1% beef extract, pH 9.5) in a sterile plastic bag. After 20 min at room temperature with constant rocking (approximately 70 oscillations/min) to remove the viruses from the surface of the material, the preparation was distributed into clean centrifuge tubes. After centrifugation at 10,000×g for 30 min at 4˚C, then the vegetable matter was discarded, the supernatant was transferred to clean centrifuge tubes, and the pH was adjusted to 7.2 ± 0.3. For PEG precipitation, 0.25 volumes of 50% (w/v) polyethylene glycol 8000/1.5 M NaCl were added to the eluates and stirred for two hours (h) at room temperature. After additional centrifugation for 30 min at 10,000×g at 4˚C, the pellets were dissolved in 500 μl of 10 mM PBS and stored at −20˚C until use.

2.5. Treatment of Feces and Manure Samples

Manure samples were processed using a method adapted from Kokkinos et al. [30]. A 10% manure suspension in phosphate-buffered saline was prepared, vortexed for 15 sec and centrifuged at 10,000×g for 10 min. The supernatant was collected and stored at −20˚C for subsequent analysis.

2.6. Nucleic Acid Extraction

Fresh produce suspensions and irrigation water samples were first treated with chloroform-butanol (1:1). These mixtures were briefly homogenized and then centrifuged at 10000× g for 15 min. The upper aqueous phase of each sample served as the sample for the final nucleic acid extraction. Nucleic acids were extracted using a FavorPrep™ viral nucleic acid extraction kit according to the manufacturer’s instructions. The samples were stored at −20˚C.

2.7. Nested PCR

Viral DNA extracted from the samples was detected by a HAdV-specific nested PCR protocol targeting the hexon capsid protein-encoding gene, as previously described [31], using Solis BioDyne’s 5× FIREPol® Master Mix Ready to Load kit, according to the manufacturer’s instructions. The primer sequences are shown in Table 1. The first PCR was performed using 3.5 μl of extracted viral DNA for cDNA synthesis with FIREPol® DNA polymerase. The thermocycling conditions were 3 min at 95˚C, followed by 30 cycles of 1 min at 95˚C, 1 min at 51˚C and 1 min at 72˚C. The final extension time was 10 min at 72˚C. For nested PCR, 5 μl of cDNA template obtained from the first PCR was used. The thermocycling conditions were 3 min at 95˚C, followed by 30 cycles of 1 min at 95˚C, 1 min at 53˚C, and 1 min at 72˚C, with a final extension of 10 min at 72˚C. Nuclease-free water was used in all experiments as a negative control. PCR products (5 μl) were analyzed on 2% agarose gels. Fragment sizes were compared using a commercially available standard 100 bp DNA ladder (Solis Biodyne, Estonia).

Table 1. Primers used for amplification of the adenovirus hexon protein-encoding gene.

Primers

Sequence (5 3)

Amplicon size

Reference

AV1b

GCCCGAGTGGTCTTACATGCACATC

First PCR

301 pb

[31]

AV2b

CAGCACGCCGCGGATGTCAAAGT

AV3c

GCCACCGAGACGTACTTCAGCCTG

Nested PCR

143 pb

AV4c

TTGTACGAGTACGCGGTATCCTCGCGGTC

2.8. Statistical Analysis

Microsoft Excel 2019 and Sphinx V5 software were used for data entry, analysis and some graphics. The lower and upper limits of the 95% confidence interval (CI) for a proportion were also calculated.

3. Results

3.1. Production Site Characteristics

Market garden sites have been developed around engineered water sources (dams, canals) and wastewater sources (domestic or industrial) (Figure 2). Given the distance between these dams and the sites, the market gardeners dug ditches to drain the water from the dam to the market garden perimeters. However, 71% of farmers use wells as their sole source of water for irrigation.

Figure 2. Characteristics of the production sites. Legend: (a) Tomato fields; (b) Irrigation water sources (dams near fields); (c) Lettuce fields; (d) Strawberry fields; (e) Carrot fields; (f) Manual irrigation method; (g) Ditches; (h) Manure in lettuce fields; ((i) (j)) Irrigation water sources (well); (k) Waste in lettuce fields; (l) Manure.

The market garden sites are of the traditional type, laid out in the open air, with no protection against urban wastes, wind, sun or animals (sheep, goats, pigs, rodents, reptiles, birds). Polyculture was the farming technique adopted at the sites (Figure 3). The crops found at the sites and eaten raw were leaf and bulb onions (Allium cepa), tomatoes (Solanum lycopersicum), eggplants (Solanum melogena), pepper (Capsicum frutescens), lettuce (Lactiva sativa), carrots (Daucus carota), strawberries (Fragaria sp.), cucumbers (Cucumis sativus), bell pepper (Capsicum annuum), celery (Apium graveolens L.) and parsley (Petroselinum crispum). Fresh fruit and vegetable production was dominated by lettuce (79%), onion (35.7%) and tomato (33.3%).

3.2. Sociodemographic Characteristics of the Producers

The producers interviewed were all from Burkina Faso, mostly men (66.67%), aged between 35 and 45 years (65%). Sixty-nine percent of the producers said

Figure 3. Types of fruits and vegetables grown on market garden sites.

they had received no basic education, and 43% had been growing vegetables for more than 20 years (Table 2).

Table 2. Sociodemographic characteristics of producers.

Parameters (n = 300)

Proportion

Gender


Male

206 (68.67%)

Female

94 (31.33%)

Nationality


Burkinabè

300 (100%)

Non-Burkinabè

0

Age


Under 30 years old

28 (9.33%)

30 to 45 years old

195 (65%)

Over 45 years old

77 (25.67%)

background


Out of school

209 (69.67%)

Primary

62 (20.67%)

Secondary

28 (9.33%)

Higher education

1 (0.33%)

Experience in market gardening


Less than 5 years old

59 (19.67%)

5 to 15 years

49 (16.33%)

15 to 20 years

63 (21%)

More than 20 years old

129 (43%)

3.3. Producers’ Knowledge of Health Risks

The majority of growers (77.3%) had no knowledge of the risks associated with using (untreated) wastewater to irrigate market garden plots (Figure 4). Those aware of the health risks associated with wastewater use (22.7%) cited stomach upset (13.7%), diarrhea (6%) and vomiting (3%) as symptoms of ingesting irrigation water.

Figure 4. Farmers’ level of awareness of the risks associated with using (untreated) wastewater for irrigation and symptoms listed by those who are aware of these risks.

3.4. Biocontamination Risk Practices for Fruits and Vegetables in the Field

The majority of fields visited (68.3%) had no sanitary facilities, and 18% had no means of protection. Our survey revealed that almost all producers (98.3%) used animal manure (chicken, pig, beef, and sheep) to fertilize the soil. In addition, 63.7% and 45.3% of respondents reported the presence of livestock and rodents in and around the fruit and vegetable plant growing sites, respectively.

Producers (98.7%) mainly used water from various sources (wells, dams, canals or wastewater from abattoirs, domestic or industrial) for crop irrigation without prior treatment.

Harvested products are placed directly on the ground by 51.3% of producers, and 89.9% of producers wash them with irrigation water. During our survey, we observed that most crops are put into bags or baskets and transported to markets by motorcycle or tricycle (Figure 5(a) and Figure 5(b)).

(a)

(b)

Figure 5. (a) Harvesting and transporting fruits and vegetables; (b): Biocontamination risk practices for fruits and vegetables in the field.

3.5. Prevalence of Adenoviruses in Fruits, Vegetables, Wastewater and Manure

A total of eight (17) samples (5.94%) (CI95, 3.2% - 8.7%) tested positive for adenoviruses (Table 3). However, 7.14% (3/42) of the tomatoes, 6.7% (2/30) of the lettuce, 20% (6/30) of the strawberries, and 7.5% (6/80) of the irrigation water tested positive for adenoviruses. No adenovirus was detected in the carrot or manure samples.

Table 3. Prevalence of adenovirus in fruits, vegetables, manure and irrigation water.

Product

Prevalence number and (percentage) in sampling sites

Boulmiougou

Silmandé

Tanghin

Loumbila

Total

Carrots

0/0 (0%)

0/0 (0%)

0/30 (0%)

0/0 (0%)

0/30 (0%)

Strawberries

6/30 (20%)

0/0 (0%)

0/0 (0%)

0/0 (0%)

6/30(20%)

Tomatoes

0/11 (0%)

0/0 (0%)

0/0 (0%)

3/31 (9.7%)

3/42 (7.14%)

Lettuces

2/20 (10%)

0/10 (0%)

0/10 (0%)

0/0 (0%)

2/30 (6.7%)

Manure

0/17 (0%)

0/18 (0%)

0/24 (0%)

0/15 (0%)

0/74 (0%)

Water

4/25 (16%)

0/15 (0%)

0/15 (0%)

2/25 (8%)

6/80 (7.50%)

4. Discussion

Market garden production in Burkina Faso is characterized by small-scale organization of water sources on small plots with polycultures of plant species. This seasonal polyculture system is irrigated with various water sources. The plants were fertilized with animal manure without any sanitation processes. Market gardens are open-air plots characterized by the presence of weeds, urban waste and animals. These characteristics have also been observed by several authors around major urban centers, such as Bobo-Dioulasso, Ouagadougou and Benin [32]-[34]. All the market garden sites were located close to engineered water sources, such as dams. Market gardening is a dry-season activity in Burkina Faso, and water is essential to its success. However, 71% of the farmers dug shallow wells in their fields and used this untreated water for irrigation. These observations have also been made in Côte d’Ivoire, where the majority of market gardeners use well water for irrigation [35]. For most farmers, access to water from dams means extra work. They have to dig ditches to bring water from the dams to the fields. At any moment, the water level in the dam drops considerably, making it difficult for the water to reach the field [36].

The sociodemographic data in this study are consistent with those reported in Burkina [33] [37], Mali [38], Nigeria [36] and Benin [39]. This could be explained by physical constraints, namely, the drudgery of irrigation practices dominated by manual labor [40]. Indeed, market gardening, as described above, is less mechanized and requires a great deal of time and physical effort for irrigation and related activities [35]. Cultural considerations also give men more rights to the land than women. The market gardeners were mostly young (15 - 30 years old) and had a low level of education (69.7%). These rates are in agreement with those observed by Ouédraogo et al. [40] who reported that the median age of market gardeners is 40 and that 60% of them had no level of education. However, Hougbenou [39] showed that in Benin, 76.09% of market gardeners were educated, and 59% were over 40 years old. The high proportion of young people involved in agriculture could also be explained by rural exodus and, above all, unemployment. Indeed, young people move to cities in search of better living conditions and find themselves involved in these activities [38]. In addition, the low level of education among market gardeners could be because most young graduates only seek work in the formal sector [33].

The majority of the market garden sites (68.3%) had no sanitary facilities, were close to livestock areas and housed free-ranging domestic animals. These practices can lead to contamination of fresh produce, as the presence of pathogenic microorganisms in animal excrement has been reported [30] [41]. Animals such as sheep, goats, pigs, cattle, chickens and rodents excrete pathogenic agents such as Salmonella spp., E. coli and enteric viruses in their feces [42] [43]. The lack of sanitary facilities leads to open defecation around sites, which can contaminate crops through runoff [44]. Wastewater, a veritable vector for many pathogens [45], is a major source of crop biocontamination if it is used for irrigation without adequate treatment. The survey also revealed that 98.3% of the market gardeners used animal manure and that 52% of them did not treat it before use. Nabie [33] reported that 91.4% of growers used manure as fertilizer, and according to CIRAD [46], the composting phase of animal dejecta is rarely accepted by market gardeners. The use of non-composted manure as fertilizer is a risk factor for contamination of fresh produce [47] [48].

The survey results show that 77.3% of growers were unaware of the risks associated with using untreated wastewater for irrigation. The same observation was made by Wognin et al. [49], who reported a rate of 91.69%. These risks of biocontamination of fresh produce could be justified, on the one hand, by their low level of education and, on the other hand, by their ignorance of good farming practices and the impact of risky practices on crop quality and consumer health.

The detection rate (8.33%) observed in fresh produce is lower than that reported in Egypt (55.5%) [50]. The presence of adenovirus in fresh produce could be due, on the one hand, to the risk practices of market gardeners and, on the other hand, to the level of hygiene in the environment. According to the WHO, poor hygiene among growers, the use of soiled harvesting tools and human and animal feces are all factors in the contamination of fresh produce in the field [44]. Indeed, contamination by the main etiological agents of gastroenteritis is attributable to the environment [51]. Poor environmental hygiene can also lead to contamination of these waters by various microorganisms [52]. The detection rate of the adenovirus genome in water samples (7.5%) is in agreement with that found by Opere et al. [53] (5.09%) in the water of a lake in Kenya. This presence was justified by the proximity of latrines and wastewater treatment areas to the lake. However, this rate was very low compared to those reported by Ibrahim [54] for hospital wastewater in Tunisia (64%) and by Amdiouni et al. [55] for (untreated) wastewater in Morocco, North Africa (66%). This difference could be explained, on the one hand, by the origin or provenance of the wastewater analyzed and, on the other hand, by variations in rainfall between samplings [56] [57]. Indeed, studies in Egypt have shown higher HAdV detection rates in raw wastewater from treatment plants than in river water or treated wastewater [58]-[60]. Other studies have shown that high viral prevalence in wastewater is linked to reduced water flow during the dry season, resulting in less dilution of viral particles and, consequently, increased viral contamination when fecal matter is discharged into the river [61].

Evidence of zoonotic transmission of AdV has been documented in a meta-analysis reporting cases where AdV crossed host species barriers between humans and non-human primates, bats, felines, pigs, canids, sheep and goats [62]. However, in this study, adenovirus was not detected in any of the manure samples. This could be explained by the sensitivity of the detection method used or by the fact that virus survival is affected by composting or solar radiation [63] [64]. The survey showed that 23% of the market gardeners composted their manure, and 25% exposed it to sunlight. Another limitation of this study is the lack of clinical data. Future studies involving sequence analysis are needed to compare strains detected in clinical and environmental samples.

5. Conclusion

This study showed that fresh raw produce could be contaminated with adenovirus, causing a health risk to consumers. Untreated irrigation water can be one of the sources of this contamination. Animal access to market garden sites and the absence of good hygiene practices are also factors favoring biocontamination of these products during production. However, it is essential to assess the viral load and characterize these adenoviruses to implement a better sanitary strategy for fruit and vegetable production and reduce the risk associated with their consumption.

Authors’ Contributions

KAT, PR and NB: Conceptualization, formal analysis, funding acquisition, methodology, project administration, resources, supervision, formal analysis and investigation. KAT and MS: Drafted the manuscript. KAT and NB: Data curation, investigation, writing and editing. KAT: Resources, validation, writing and editing. KAT, MS, JBO and BLO: Review and editing. All authors contributed to the article and approved the submitted version.

Funding

This work was supported by the International Foundation for Science (IFS), grant N˚ 1 I3-E 039216 to TRAORE, Kuan Abdoulaye, in Université Norbert ZONGO in collaboration with LaBESTA from Université Joseph KI ZERBO.

Appendix

Conflicts of Interest

The authors declare no conflicts of interest regarding the publication of this paper.

References

[1] FAO (2012) Growing Greener Cities in Africa. First Status Report on Urban and Peri-Urban Horticulture in Africa. Food and Agriculture Organization of the United Nations, 116 p.
https://www.fao.org/4/i3002e/i3002e.pdf
[2] FAO (2021) Fruits et legumes-éléments essentiels de ton alimentation. Année Internationale des Fruits et des Legumes, 94 p.
https://openknowledge.fao.org/server/api/core/bitstreams/b53a8d29-ce81-4a1b-9a1e-acecf97959c0/content#:~:text=(ONU)%20a%20proclam%C3%A9%202021%20%C2%AB,vie%20diversifi%C3%A9s%2C%20%C3%A9quilibr%C3%A9s%20et%20sains
[3] FAO (2021) World Food and Agriculture—Statistical Yearbook. 368 p.
https://openknowledge.fao.org/server/api/core/bitstreams/522c9fe3-0fe2-47ea-8aac-f85bb6507776/content
[4] WHO (2005) Fruits et légumes pour la santé: Rapport de l’atelier conjoint FAO/OMS, 1er au 3 septembre 2004 Kobe (Japon). 55 p.
https://iris.who.int/handle/10665/154592
[5] WHO (2015) Foodborne Disease Burden Epidemiology Reference Group 2007-2015. 265 p.
https://iris.who.int/bitstream/handle/10665/199350/9789241565165_eng.pdf?sequence=1
[6] Butot, S., Putallaz, T. and Sánchez, G. (2007) Procedure for Rapid Concentration and Detection of Enteric Viruses from Berries and Vegetables. Applied and Environmental Microbiology, 73, 186-192.[CrossRef] [PubMed]
[7] Cheong, S., Lee, C., Song, S.W., Choi, W.C., Lee, C.H. and Kim, S. (2009) Enteric Viruses in Raw Vegetables and Groundwater Used for Irrigation in South Korea. Applied and Environmental Microbiology, 75, 7745-7751.[CrossRef] [PubMed]
[8] Papafragkou, E., Plante, M., Mattison, K., Bidawid, S., Karthikeyan, K., Farber, J.M., et al. (2008) Rapid and Sensitive Detection of Hepatitis a Virus in Representative Food Matrices. Journal of Virological Methods, 147, 177-187.[CrossRef] [PubMed]
[9] Randazzo, W., Vásquez-García, A., Bracho, M.A., Alcaraz, M.J., Aznar, R. and Sánchez, G. (2018) Hepatitis E Virus in Lettuce and Water Samples: A Method-Comparison Study. International Journal of Food Microbiology, 277, 34-40.[CrossRef] [PubMed]
[10] Gallot, C., Grout, L., Roque-Afonso, A., Couturier, E., Carrillo-Santisteve, P., Pouey, J., et al. (2011) Hepatitis a Associated with Semidried Tomatoes, France, 2010. Emerging Infectious Diseases, 17, 566-567.[CrossRef] [PubMed]
[11] Robinson, C.M., Singh, G., Lee, J.Y., Dehghan, S., Rajaiya, J., Liu, E.B., et al. (2013) Molecular Evolution of Human Adenoviruses. Scientific Reports, 3, Article 1812.[CrossRef] [PubMed]
[12] Crenshaw, B.J., Jones, L.B., Bell, C.R., Kumar, S. and Matthews, Q.L. (2019) Perspective on Adenoviruses: Epidemiology, Pathogenicity, and Gene Therapy. Biomedicines, 7, Article No. 61.[CrossRef] [PubMed]
[13] Mennechet, F.J.D., Paris, O., Ouoba, A.R., Salazar Arenas, S., Sirima, S.B., Takoudjou Dzomo, G.R., et al. (2019) A Review of 65 Years of Human Adenovirus Seroprevalence. Expert Review of Vaccines, 18, 597-613.[CrossRef] [PubMed]
[14] HAdV Working Group (2022)
http://hadvwg.gmu.edu
[15] Bonkoungou, I.J.O., Haukka, K., Österblad, M., Hakanen, A.J., Traoré, A.S., Barro, N., et al. (2013) Bacterial and Viral Etiology of Childhood Diarrhea in Ouagadougou, Burkina Faso. BMC Pediatrics, 13, Article No. 36.[CrossRef] [PubMed]
[16] Ouédraogo, N., Kaplon, J., Bonkoungou, I.J.O., Traoré, A.S., Pothier, P., Barro, N., et al. (2016) Prevalence and Genetic Diversity of Enteric Viruses in Children with Diarrhea in Ouagadougou, Burkina Faso. PLOS ONE, 11, e0153652.[CrossRef] [PubMed]
[17] Ouedraogo, N., Ngangas, S.M.T., Bonkoungou, I.J.O., Tiendrebeogo, A.B., Traore, K.A., Sanou, I., et al. (2017) Temporal Distribution of Gastroenteritis Viruses in Ouagadougou, Burkina Faso: Seasonality of Rotavirus. BMC Public Health, 17, Article No. 274.[CrossRef] [PubMed]
[18] Killerby, M.E., Rozwadowski, F., Lu, X., Caulcrick-Grimes, M., McHugh, L., Haldeman, A.M., et al. (2019) Respiratory Illness Associated with Emergent Human Adenovirus Genome Type 7d, New Jersey, 2016-2017. Open Forum Infectious Diseases, 6, ofz017.[CrossRef] [PubMed]
[19] Kajon, A. and Lynch, J. (2016) Adenovirus: Epidemiology, Global Spread of Novel Serotypes, and Advances in Treatment and Prevention. Seminars in Respiratory and Critical Care Medicine, 37, 586-602.[CrossRef] [PubMed]
[20] Yates, M.V. (2014) Adenovirus. In: Percival, S.L., Yates, M.V., Williams, D.W., Chalmers, R.M. and Gray, N.F., Eds., Microbiology of Waterborne Diseases, Elsevier, 471-477.[CrossRef
[21] Elmahdy, E.M., Shaheen, M.N.F., Rizk, N.M. and Saad-Hussein, A. (2020) Quantitative Detection of Human Adenovirus and Human Rotavirus Group a in Wastewater and El-Rahawy Drainage Canal Influencing River Nile in the North of Giza, Egypt. Food and Environmental Virology, 12, 218-225.[CrossRef] [PubMed]
[22] Farkas, K., Marshall, M., Cooper, D., McDonald, J.E., Malham, S.K., Peters, D.E., et al. (2018) Seasonal and Diurnal Surveillance of Treated and Untreated Wastewater for Human Enteric Viruses. Environmental Science and Pollution Research, 25, 33391-33401.[CrossRef] [PubMed]
[23] Fong, T., Phanikumar, M.S., Xagoraraki, I. and Rose, J.B. (2010) Quantitative Detection of Human Adenoviruses in Wastewater and Combined Sewer Overflows Influencing a Michigan River. Applied and Environmental Microbiology, 76, 715-723.[CrossRef] [PubMed]
[24] Mena, K.D. and Gerba, C.P. (n.d.) Waterborne Adenovirus. In: Whitacre, D.M., Ed., Reviews of Environmental Contamination and Toxicology, Springer, 133-167.[CrossRef] [PubMed]
[25] La Rosa, G., Iaconelli, M., Pourshaban, M. and Muscillo, M. (2010) Detection and Molecular Characterization of Noroviruses from Five Sewage Treatment Plants in Central Italy. Water Research, 44, 1777-1784.[CrossRef] [PubMed]
[26] La Rosa, G., Pourshaban, M., Iaconelli, M. and Muscillo, M. (2010) Quantitative Real-Time PCR of Enteric Viruses in Influent and Effluent Samples from Wastewater Treatment Plants in Italy. Annali dellIstituto Superiore di Sanità, 46, 266-273.
[27] Maunula, L., Kaupke, A., Vasickova, P., Söderberg, K., Kozyra, I., Lazic, S., et al. (2013) Tracing Enteric Viruses in the European Berry Fruit Supply Chain. International Journal of Food Microbiology, 167, 177-185.[CrossRef] [PubMed]
[28] Ahmad, T., Waheed, Y., Tahir, S., Safi, S.Z., Fatima, K., Afzal, M.S., et al. (2010) Frequency of HEV Contamination in Sewerage Waters in Pakistan. The Journal of Infection in Developing Countries, 4, 842-845.[CrossRef] [PubMed]
[29] Coudray-Meunier, C., Fraisse, A., Martin-Latil, S., Guillier, L. and Perelle, S. (2013) Discrimination of Infectious Hepatitis a Virus and Rotavirus by Combining Dyes and Surfactants with RT-qPCR. BMC Microbiology, 13, Article No. 216.[CrossRef] [PubMed]
[30] Kokkinos, P., Kozyra, I., Lazic, S., Bouwknegt, M., Rutjes, S., Willems, K., et al. (2012) Harmonised Investigation of the Occurrence of Human Enteric Viruses in the Leafy Green Vegetable Supply Chain in Three European Countries. Food and Environmental Virology, 4, 179-191.[CrossRef] [PubMed]
[31] Formiga-Cruz, M., Hundesa, A., Clemente-Casares, P., Albiñana-Gimenez, N., Allard, A. and Girones, R. (2005) Nested Multiplex PCR Assay for Detection of Human Enteric Viruses in Shellfish and Sewage. Journal of Virological Methods, 125, 111-118.[CrossRef] [PubMed]
[32] Ahouangninou, C., Martin, T., Komlan, F., Cledjo, P., Kpenavoun Chogou, S., Nouatin, G. and Fayomi, B. (2015) Évaluation de la durabilité de la production maraîchère au sud du Bénin. Cahiers du CBRST, 2, 98-126.
[33] Nabie, B. (2018) Analyse des pratiques phytosanitaires et des facteurs d’adoption de la gestion intégrée des nuisibles en production maraîchère en milieu urbain et périurbain au Burkina Faso: Cas de la ville de Ouagadougou. Mémoire de fin d’Étude en Production Intégrée et Préservation des Ressources Naturelles en Milieu Urbain et Périurbain, 96 p.
https://matheo.uliege.be/bitstream/2268.2/5071/4/s172983Nabie2018.pdf
[34] Lamine, P. (2017) Pratiques maraîchères et risques de pollution environnementale par les pesticides: Cas de quelques exploitations de Sakaby et de Dogona à Bobo-Dioulasso. Mémoire de fin de Cycle d’Ingénieur du Développement Rural, 86 p.
https://bibliovirtuelle.u-naziboni.bf/biblio/opac_css/docnume/idr/environnement2/IDR-2017-POO-PRA.pdf
[35] Toe, E. (2018) Assessment of Risk Factors Bio Contamination by Salmonella and Escherichia Virulent Coli of the Food Chain of Vegetables in Abidjan (Ivory Coast). Université Nangui Abrogoua (Côte d’Ivoire).
https://hal.science/tel-02099115
[36] Ofoka, C.I., Chah, J.M. and Madukwe, M.C. (2013) Characteristics of Market Garden in Anambra State, Nigeria. African Journal of Agricultural Research, 8, 3950-3957.
[37] MAH (2011) Rapport général du module maraîchage. 318 p.
https://www.google.com/url?sa=t&rct=j&q=&esrc=s&source=web&cd=&ved=2ahUKEwjwjt2Cq8KHAxWRTkEAHaoEHZ0QFnoECBMQAQ&url=http%3A%2F%2Fcns.bf%2FIMG%2Fpdf%2Frga_maraichage_derniere_version.pdf&usg=AOvVaw3YkiWSv3P8ZRexW9C6V1mx&opi=89978449
[38] Samake, M., Samake, S. and Keïta, O. (2022) Rôle du maraichage dans le développement socioéconomique à l’Office du Périmètre Irrigué de Baguineda. International Journal of Biological and Chemical Sciences, 16, 213-226.[CrossRef
[39] Hougbenou, J. (2020) Characteristics of Urban Market Gardening in Porto-Novo, Republic of Benin, West Africa. International Journal of Agricultural Science, 4, 66-76.
[40] Ouédraogo, R.A., Kambiré, F.C., Kestemont, M. and Bielders, C.L. (2019) Caractériser la diversité des exploitations maraîchères de la région de Bobo-Dioulasso au Burkina Faso pour faciliter leur transition agroécologique. Cahiers Agricultures, 28, Article No. 20.[CrossRef
[41] Dubois-Brissonnet, F. and Guillier, L. (2020) Les maladies microbiennes d’origine alimentaire. Cahiers de Nutrition et de Diététique, 55, 30-38.[CrossRef
[42] Mantha, S., Anderson, A., Acharya, S.P., Harwood, V.J. and Weidhaas, J. (2017) Transport and Attenuation of Salmonella enterica, Fecal Indicator Bacteria and a Poultry Litter Marker Gene Are Correlated in Soil Columns. Science of the Total Environment, 598, 204-212.[CrossRef] [PubMed]
[43] Vasco, K., Graham, J.P. and Trueba, G. (2016) Detection of Zoonotic Enteropathogens in Children and Domestic Animals in a Semirural Community in Ecuador. Applied and Environmental Microbiology, 82, 4218-4224.[CrossRef] [PubMed]
[44] WHO (2012) Cinq clefs pour cultiver des fruits et des légumes plus sûrs: Promouvoir la santé en réduisant la contamination microbienne. 32 p.
https://iris.who.int/bitstream/handle/10665/43614/9789242594638_fre.pdf?sequence=1
[45] Koffi-Nevry, R., Assemand, E.F., Wognin, A.S. and Koussemon, M. (2012) Origine des témoins de contamination fécale de l’eau d’arrosage de la laitue (Lactuca sativa) cultivée dans la zone péri-urbaine d’Abidjan. Journal of Applied Biosciences, 52, 3669-3675.
[46] Dugué, P. and Simon, S. (2016) (2016) Etude de faisabilité du projet maraichage agroécologique dans la région de Ndiongolor Diouroup (Sénégal): Diagnostic de l’activité de maraichage dans les sites pilotes et la région. Propositions pour la poursuite du projet. CIRAD-IRRIGASC, 50 p.
https://agritrop.cirad.fr/585274/
[47] Balali, G.I., Yar, D.D., Afua Dela, V.G. and Adjei-Kusi, P. (2020) Microbial Contamination, an Increasing Threat to the Consumption of Fresh Fruits and Vegetables in Today’s World. International Journal of Microbiology, 2020, Article ID: 3029295.[CrossRef] [PubMed]
[48] Degaga, B., Sebsibe, I., Belete, T. and Asmamaw, A. (2022) Microbial Quality and Safety of Raw Vegetables of Fiche Town, Oromia, Ethiopia. Journal of Environmental and Public Health, 2022, Article ID: 2556858.[CrossRef] [PubMed]
[49] Wognin, A., Ouffoue, S., Assemand, E., Tano, K. and Koffi-Nevry, R. (2014) Perception des risques sanitaires dans le maraîchage à Abidjan, Côte d’Ivoire. International Journal of Biological and Chemical Sciences, 7, 1829-1837.[CrossRef
[50] Shaheen, N., Irfan, N.M., Khan, I.N., Islam, S., Islam, M.S. and Ahmed, M.K. (2016) Presence of Heavy Metals in Fruits and Vegetables: Health Risk Implications in Bangladesh. Chemosphere, 152, 431-438.[CrossRef] [PubMed]
[51] Purpari, G., Macaluso, G., Di Bella, S., Gucciardi, F., Mira, F., Di Marco, P., et al. (2019) Molecular Characterization of Human Enteric Viruses in Food, Water Samples, and Surface Swabs in Sicily. International Journal of Infectious Diseases, 80, 66-72.[CrossRef] [PubMed]
[52] de Castro Carvalho, S.V., Rogovski, P., Cadamuro, R.D., Viancelli, A., Michelon, W., dos Reis, D.A., et al. (2019) Co-Contamination of Food Products from Family Farms in an Environmental Disaster Area in Southeast Brazil with Pathogenic Bacteria and Enteric Viruses. Archives of Virology, 165, 715-718.[CrossRef] [PubMed]
[53] Opere, W.M., John, M. and Ombori, O. (2020) Molecular Detection of Human Enteric Adenoviruses in Water Samples Collected from Lake Victoria Waters along Homa Bay Town, Homa Bay County, Kenya. Food and Environmental Virology, 13, 32-43.[CrossRef] [PubMed]
[54] Ibrahim, C., Hassen, A., Pothier, P., Mejri, S. and Hammami, S. (2018) Molecular Detection and Genotypic Characterization of Enteric Adenoviruses in a Hospital Wastewater. Environmental Science and Pollution Research, 25, 10977-10987.[CrossRef] [PubMed]
[55] Amdiouni, H., Faouzi, A., Fariat, N., Hassar, M., Soukri, A. and Nourlil, J. (2012) Detection and Molecular Identification of Human Adenoviruses and Enteroviruses in Wastewater from Morocco. Letters in Applied Microbiology, 54, 359-366.[CrossRef] [PubMed]
[56] Canan-Rochenbach, G., Barreiros, M.A.B., Lima, A.O.S., Bauda, P., Sanches-Simões, E., Pimentel-Almeida, W., et al. (2022) Characterization of Bacterial Resistance in Treated Hospital Wastewater. Environmental Technology, 45, 120-128.[CrossRef] [PubMed]
[57] Zhang, X., Yan, S., Chen, J., Tyagi, R.D. and Li, J. (2020) Physical, Chemical, and Biological Impact (Hazard) of Hospital Wastewater on Environment: Presence of Pharmaceuticals, Pathogens, and Antibiotic-Resistance Genes. In: Tyagi, R.D., et al., Eds., Current Developments in Biotechnology and Bioengineering, Elsevier, 79-102.[CrossRef
[58] El-Senousy, W.M., Ghanem, H.E. and Kamel, M.A. (2013) Molecular Epidemiology of Human Adenoviruses and Rotaviruses as Candidate Viral Indicators in the Egyptian Sewage and Water Samples. World Applied Sciences Journal, 27, 1235-1247.
[59] Elmahdy, E.M., Ahmed, N.I., Shaheen, M.N.F., Mohamed, E.B. and Loutfy, S.A. (2019) Molecular Detection of Human Adenovirus in Urban Wastewater in Egypt and among Children Suffering from Acute Gastroenteritis. Journal of Water and Health, 17, 287-294.[CrossRef] [PubMed]
[60] Badr, K.R., Elmahdy, E.M. and Shaheen, M.N.F. (2024) Molecular Detection of Human Adenovirus and Human Bocavirus in Wastewater and Drain Water in the Western Nile Delta of Egypt. Water Supply, 24, 453-464.[CrossRef
[61] Rusiñol, M., Fernandez-Cassi, X., Hundesa, A., Vieira, C., Kern, A., Eriksson, I., et al. (2014) Application of Human and Animal Viral Microbial Source Tracking Tools in Fresh and Marine Waters from Five Different Geographical Areas. Water Research, 59, 119-129.[CrossRef] [PubMed]
[62] Borkenhagen, L.K., Fieldhouse, J.K., Seto, D. and Gray, G.C. (2019) Are Adenoviruses Zoonotic? A Systematic Review of the Evidence. Emerging Microbes & Infections, 8, 1679-1687.[CrossRef] [PubMed]
[63] Bertrand, I., Schijven, J.F., Sánchez, G., Wyn-Jones, P., Ottoson, J., Morin, T., et al. (2012) The Impact of Temperature on the Inactivation of Enteric Viruses in Food and Water: A Review. Journal of Applied Microbiology, 112, 1059-1074.[CrossRef] [PubMed]
[64] Bosshard, F., Armand, F., Hamelin, R. and Kohn, T. (2013) Mechanisms of Human Adenovirus Inactivation by Sunlight and UVC Light as Examined by Quantitative PCR and Quantitative Proteomics. Applied and Environmental Microbiology, 79, 1325-1332.[CrossRef] [PubMed]

Copyright © 2025 by authors and Scientific Research Publishing Inc.

Creative Commons License

This work and the related PDF file are licensed under a Creative Commons Attribution 4.0 International License.