RNA Interference Mediated Silencing of Tissue Factor in Human Umbilical Vein Endothelial Cells ()
1. Introduction
Placental abruption (PA) refers to the complete or partial separation of a normal placenta from the wall of the uterus before delivery. PA is not only a major cause of bleeding but an important cause of coagulation dysfunction in neonates after birth in the Department of Obstetrics [1] [2] . PA may cause stillbirth, premature delivery, neonatal asphyxia, neonatal anemia and coagulation disorders. The PA related coagulation disorders are closely associated with some complications such as early DIC, scleroderma, intracranial hemorrhage and pulmonary hemorrhage. Previous studies reported that the incidence of PA is 0.49% - 1.8% [3] [4] . In China, the incidence of PA is 0.46% - 0.21% and PA accounts for 10% - 20% of deaths in perinatal period [5] . Studies have shown that a large amount of tissue factor (TF) is released from the placental villi and decidua in PA and forms TF-VII complex with fetal F-VII. The activated TF-VII complex may induce coagulation cascade, resulting in abnormal coagulation and finally disseminated intravascular coagulation (DIC) [6] [7] [8] . TF expression occurs at the initiation of coagulation, and inhibition of TF expression has the possibility to reduce the risk for coagulation dysfunction in PA neonates. In the present study, RNA interference (RNAi) [9] was employed to construct a vector expressing TF which was then transfected into human umbilical vein endothelial cells (HUVECs) to silence TF expression. Our findings may provide a new way for the clinical therapy and prevention of coagulation dysfunction in PA neonates.
2. Materials and Methods
2.1. Main Materials
RPMI 1640 medium, collagenase II, trypsin (Gibco), fetal bovine serum (Hyclone), epidermal growth factor (Peprotec), VIII detection kit (Antibody Diagnotica), anti-human TF monoclonal antibody (R & D Systems, Inc), goat anti-rabbit immunofluorescene antibody (Zhongshan Golden Bridge Biotech Co., Ltd), BLOCK-iTTM U6 RNAi Entry Vector kit, Gene Juice Transfection Reagent Novagen (Invitrogen), sequences for TF silencing (Shanghai Sangong Biotech Co., Ltd.), plasmid extraction Midi Kit (Qiagen) and other domestic analytically pure reagents were used in this study.
2.2. Methods
2.2.1. In Vitro Culture and Identification of HUVECs
The umbilical cord (about
10 cm
) was collected in an aseptical condition during delivery, and the blood in the umbilical cord was removed by flushing the umbilical cord. Then, 0.1% collagenase II (5 ml) was added, followed by digestion for 12 min at 37˚C. The solution was harvested after digestion, and the umbilical cord was flushed again with PBS. After addition of FBS, centrifugation was done, and the supernatant was removed. The cells were re-suspended in complete medium and then seeded into 25-cm2 dish, followed by incubation at 37˚C in an environment with 5% CO2 for 24 h. Subsequently, epidermal growth factor (EGF) was added, followed by incubation for 48 - 72 h. Immunohistochemistry was done for the measurement of VIII protein expression. Cells of 2nd and 3rd generation were harvested for following experiments.
2.2.2. Construction and Identification of pENTRTM/U6-shRNA/TF
According to the interference sequences T12 and T6 of TF, shRNA sequence was designed as follow: CACCGTTCCTTCTGACTAAAGTCCGTCCGTCGAAACGGACTTTAGTCAGAAGGAA, and ds oligo were synthesized. After annealing, the ds oligo was connected to the sticky ends of pENTRTM/U6. The resultant products were transformed into competent cells to construct pENTRTM/U6-shRNA/TF. After sequencing, the vectors were used in following experiments.
2.2.3. Detection of TF mRNA and Protein Expression in HUVECs after Transfection
HUVECs were divided into normal control group and PA group, both of which were further subdivided into 3 subgroups independently: 1) non-transfection group; 2) scramble shRNA transfection group; 3) TF shRNA transfection group (n = 3 per group). The mRNA and protein expression of TF were measured before and after transfection.
1) Transfection: HUVECs were seeded into 12-well plates at a density of 5 × 104/ml. When the cell confluence reached 60% - 80%, 0.5 μg of plasmid DNA was added, and pENTRTM/U6-shRNA/TF was transfected into HUVECs after incubation at 37˚C for 48 h.
2) Detection of TF mRNA expression by RT-PCR: The supernatant in 12-well plates was removed and two step RT-PCR was performed to detect TF mRNA expression. The conditions for reverse transcriptions were as follows: 42˚C for 20 min, 95˚C for 5 min and 5˚C for 5 min. Primers were designed according to the human TF cDNA sequence (NM_001993): 5’-CCGGCACAGCTTTAACAACCT-3’ (forward) and 5’-CGTTTGCTCTCGATTCCATGTG-3’ (reverse). Human β-actin gene (CF62602) served as an internal reference and its primers were as follows: 5’-TGGCACCACACCTTCTACAATG-3’ (forward) and 5’-CCGTGGTGGTGAAGCTGTAGC-3’ (reverse). The conditions for PCR were as follows: 94˚C for 5 min, 32 cycles at 94˚C for 30 s, 50˚C for 30 s and 72˚C for 30 s and a final extension at 72˚C for 5 min. The products were subjected to 1.5% agarose gel electrophoresis, and visualization was done with Bio-rad gel image system. Bands were analyzed with Gel-Pro Analyzer, and the optical density was determined as the mRNA expression. The mRNA expression of TF was normalized to that of β-actin.
3) Detection of TF protein expression by immunofluorescence staining: Coverslips sized 1 cm × 1 cm were placed into 12-well plates and then HUVECs were seeded into 12-well plates at a density of 5 × 104/ml. When the cell confluence reached 60% - 80%, the vectors were transfected into HUVECs. The supernatant was removed, and cells were washed with PBS. After air-drying, cells were fixed in paraformaldehyde at room temperature. Rabbit anti-human TF antibody (1:200) was added, followed by incubation in a humidified environment. Following washing in PBS thrice, FITC conjugated goat anti-rabbit secondary antibody (1:400) was added, followed by incubation for 2 h. Cells were observed under a fluorescence microscope.
2.2.4. Statistical Analysis
Statistical analysis was performed with SPSS version 17.0. Quantitative data are expressed as mean ± standard deviation (X ± SD), and categorical variables as percentages and tested with chi square test or Fisher’s exact test if necessary. Quantitative data were compared with independent sample t test between two groups and one way analysis of variance among groups. A value of P < 0.05 was considered statistically significant.
3. Results
3.1. In Vitro Culture and Identification of HUVECs
Under an inverted microscope, monolayer HUVECs were adherent to the bottom, and short-rod like or short spindle shaped. The nucleus was oval, and nucleolus was occasionally observed. Cells formed paving stone arrangement. Immunohistochemistry for VIII showed cells had green fluorescence (Figure 1).
3.2. TF mRNA Expression in HUVECs
One way analysis of variance showed there was significant difference in the TF mRNA expression between control group and PA group (F = 23.436, P < 0.01). Among different treatment groups, the TF mRNA expression was also significantly different (F = 33.630, P < 0.01). In non-transfection subgroups, the TF mRNA expression was significantly different between control group and PA group (t = 11.71, P < 0.05); in scramble shRNA transfection subgroups, the TF mRNA expression was significantly different between control group and PA group (t = 21.112, P < 0.05); in TF shRNA transfection subgroups, the TF mRNA expression was comparable between control group and PA group (t = 0.023, P > 0.05). In subgroups of control groups, the TF mRNA expression was also significant different (F = 27.657, P < 0.01); in subgroups of PA groups, the TF mRNA expression was also significant different (F = 19.299, P < 0.01); the TF mRNA expression was the lowest after TF silencing in both control groups and PA groups (Table 1).
3.3. TF Protein Expression in HUVECs
After immunofluorescence staining, HUVECs were found to have green
Table 1. Relative TF mRNA expression in different groups (
± s).
fluorescence. In non-transfection group, strong fluorescence intensity of TF was found in HUVECs and the fluorescence was diffuse; in scramble shRNA transfection group, the TF protein expression reduced as compared to non-transfection group, and the fluorescence was sparse; in TF shRNA transfection group, the TF protein expression reduced dramatically as compared to control group, and the fluorescence was more sparse (Figure 2).
4. Discussion
PA may significantly increase the morbidity and mortality of neonates and thus has been paid increasing attention to [10] [11] [12] . In PA women, neonates may develop coagulation dysfunction [13] , which significantly affects the coagulation and threaten the life. Thus, to find effective strategy to prevent and treat coagulation
(a) (b) (c)
Figure 2. Immunofluorescence staining of TF protein in HUVECs TF. (a): TF shRNA transfection group (microscope: 100×); (b): scramble shRNA transfection group (200×); (c): non-transfection group (100×).
dysfunction related diseases in neonates is imperative. TF and tissue factor pathway inhibitor (TFPI) play crucial roles in the coagulation balance. In PA, the TF content of the placenta and myometrium is significantly higher than that in plasma, but the TFPI is a very low level [14] [15] . At the site of PA, placental villi and deciduas may release a large amount of TF which, on one hand, may enter the fetal circulation via the placenta, affecting the coagulation of fetus or neonates and, on the other hand, cause the coagulation activation in the fetus, leading to the coagulation disorders in the fetus or neonates. Under this condition, the thrombin increases dramatically and degrades fibrinogen into fibrin, causing DIC [16] . In the present study, results showed the mRNA and protein expression of TF in HUVECs from PA neonates increased significantly, suggesting that pathological PA may induce the up-regulation of TF expression. This indicates that the hypercoagulable state in PA women and their neonates is mainly ascribed to the entry of excess TF in the placenta and myometrium into the circulation, leading to the coagulation in neonates, which was consistent with previously reported [16] .
RNAi technique is usually employed to efficiently and specifically down-regulate the expression of target gene and has been widely used in the studies on gene functions and gene therapy [9] [17] . In the present study, RNAi was used to silence TF expression in HUVECs and pENTRTM/U6-TF-shRNA was successfully constructed because it could significantly inhibit the TF expression in HUVECs from PA neonates and healthy neonates, suggesting the silencing of TF expression. After transfection, the TF mRNA expression reduced dramatically in HUVECs from PA neonates and healthy neonates. The TF mRNA expression reduced by 3 folds in control group and 6 folds in PA group after transfection as compared to non-transfection group. This suggests TF-siRNA has more potent ability to inhibit TF expression in HUVECs from PA neonates. Immunofluorescence staining showed both protein and mRNA expression of TF reduced dramatically after TF-shRNA transfection. In addition, pENTRTM/U6-X-shRNA was able to inhibit the TF expression in HUVECs from both PA neonates and PA neonates. This suggests that pENTRTM/U6-X-shRNA may bind to the target site in a sequence independent manner, partially affecting TF mRNA expression, which was consistent with previously reported [18] . Torgeir found the transfection efficiency of siRNA was highly dependent on the target site of target gene. Thus, RNAi has limitations to different extents in studies on gene functions and drug development.
In the present study, pENTRTM/U6 was used to successfully construct pENTRTM/U6-TF-shRNA which is then transfected into HUVECs from healthy neonates and PA neonates to inhibit the protein and mRNA expression of TF. Our findings support that silencing of TF expression is promising to block or attenuate the coagulation dysfunction in PA neonates and then reduce to the incidence of coagulation disorders in these neonates. In future studies, it is necessary to test the effects of TF expression silencing in vivo. In addition, RNAi has limitations in studies on gene function and drug development, and thus it is necessary to optimize this technique.