1. Introduction
Salmonella spp. is an important cause of human infection worldwide. Resistance to flouroquinolone, quinolone and extended spectrum Cephalosporins (ESR) that are potentially lifesaving treatment is of great concern [1-3]. Resistance to extended-spectrum Cephalosporins was the result of blaCMY, a classC plasmid-encoded ampC gene [4]. Plasmid-mediated β-lactamases were classified into six genetic clusters and blaCMY was the most prevalent one. The blaCMY has been found on plasmid of sizes variable for 7 to 180 kb [5,6].
Plasmid-mediated quinolone resistance (PMQR) was first discovered in a clinical isolate of Kelebsiella penemoniae from Birmingham, Albama collected in 1998 by Martinez-Martinez. Since then, three major groups of qnr determinant were introduced. QnrA with 6 variants, QnrB with 19 variants and QnrS with 3 variants, differ from each other by 40% or more in nucleotide sequences [7]. Resistance to quinolone and flouroquinolone arises with mutation within the DNA gyrase (topoisomerase II) and topoisomerase IV gene, especially DNA gyrase and often with decreased expression of outer membrane proteins and overexpression of efflux pump. The qnr gene encodes a pentapeptide repeat protein that protects DNA gyrase against inhibition by quinolone and flouroquinolone [8-13].
Resistance to quinolone and flouroquinolone, is often associated with ESBL-producing organisms as well as association with integron carrying qnr. Sequencing is a good way to identify qnr and ESBL producing genes [8,14].
ESBL was first explained in 1983. β-lactamases are bacterial enzymes that are inactive β-lactame antibiotic. These enzymes have the ability to hydrolyse oxyimino Cephalosporin but not Cephamycines or Carbapenems. From different parts of the world, ESBL has been introduced in Enterobacteriaceae and Pesedomonadaceaesis. These enzymes belong to the Ambler class A and D, β-lactamases. The activity of class A of β-lactamases is inhibited by β-lactamases inhibitor such as Clavulonic Acid, Sulbactam and tazobactam [15].
2. Material and Methods
2.1. Bacterial Isolates
Eighty-five isolates of Salmonella spp. were obtained from blood, stool, synovial fluid, abscess, urine and bone marrow during the years 2008 to 2010 in different provinces of Iran. Each strain obtained from a unique patient in different hospital. Stool isolates were the highest one of all the others. Biochemical and serological methods were used to identify each isolates [16].
2.2. Antimicrobial Susceptibility Test
Disk diffusion method was used to select resistant bacteria. All isolates tested and inoculated with nalidixic acid 30 µgml, Ciprofloxacin 30 µgml, Ceftazidim 30 µgml, Ceftriaxon 30 µgml, Cefepime 30 µgml, Cefpodoxime 30 µgml, Ampicilin 30 µgml by clinical and laboratory standard institute (CLSI). Disk prepared by Mast company [14,17]. Broth microdilution method [Sensitite, West Lake, OH, USA] was used to determine the minimum inhibitory concentration (MIC), confirmed by E test [AB Biodisk, Piscataway NJ, USA]. Kelebsiella pneumonia ATCC 700603 was used as quality control strain.
2.3. PCR Detection
The qnrA, qnrB, qnrS and blaCMY were detected by PCR in clinical isolates using the following primers. For qnrA_ up (GATAAAGTTTTTCAGCAAGAGG) and qnrA_ dw (ATCCAGATCCGCAAAGGTTA) to give a 700 bp product (Figure 1). Primer for qnrB_ up (ATGACGCCATTACTGTATAA) were qnrB_ dw (GATCGCAATGTGTGAAGTTT) generating a 120 bp fragment (Figure 2). Primer for qnrS_ up (ATGGAAACCTACAATCATAC) and qnrS_ dw (AAAAACACCTCGACTTAAGT) and amplicon size of qnrS was 280 bp and primers (Figure 3) for blaCMY_ up (ATGATGAAAAAATCGTTATGC) and blaCMY_ dw (TTGCAGCTTTTCAAGAATTCGC) with 800bp amplicon size (Figure 4) [4].
2.4. DNA Sequencing
The qnrA, qnrB, qnrS and blaCMY were sequenced by specific primers according to previous study. Analysis was performed using Bio Edit
(www.Mbio.ncsu.edu/Bioedit/bioedit.html). The BLAST
Figure 1. PCR products of qnrA and 50 bp DNA ladder.
Figure 2. PCR products of qnrB and 1 kb DNA ladder.
Figure 3. PCR products of qnrS and 100 bp DNA ladder.
Figure 4. PCR products of blaCMY-2 100 bp DNA ladder.
algorithm used to screen the gene bank database at the National Center of Biotechnology information website (http://www.ncbi.nlm. nih.gov/BLAST).
3. Results
3.1. Prevalence of Quinolone and Flouroquinolone and Ampicilin, Cephalosporins Resistance
Antimicrobial susceptibility pattern of 85 isolates of Salmonella were as a fallow: 9 (10.5%) isolates exhibited resistance to Ceftazidim. MIC range of these antibiotics were 0.25 - 128 µgml, 6 (7.05%) isolates to Ceftriaxone, 9 (10.5%) isolates to Cefotaxime, 6 (7.05%) isolates to Cefexime, 5 (5.88%) isolates to Cefepime, 4 (4.7%) isolates to Cefpodoxime, 12 (14.1%) isolates to ampicilin with MIC range of <4 - >2048 µgml. 49 (57.6%) isolates were resistance to Nalidixic acid and none of them were resistant to Ciprofloxacin with the MIC range of 0.64 0.125 µgml (Table 1). Among all the isolates only 2 isolates were resistant to all Cephalosporins that we tested. We showed that these two isolates were exhibited ESBL phenotype, but only one isolate had a blaCMY gene indicating that it may have the other β-lactamase gene.
3.2. Screening of Qnr and Bla Genes by PCR
Twenty two (25.8%) isolates were found to be qnrA-positive among all of the quinolone resistance isolates, qnrS and qnrB genes were detected in one (1.17%) of them. blaCMY gene were identified in twenty four (28.23%) among all of the Cephalosporins resistance isolates. Moreover, 5 isolates were found to have blaCMY and qnrA genes (Table 2). Some isolates carrying qnrA, qnrB, qnrS and blaCMY genes were selected for sequencing. The comparison between sequence results and Gene bank databases revealed identity to sequence of the qnrA, qnrB and qnrS with the accession numbers No. AY906856.1, DQ303919.1, FJ4181530.1 respectively and sequence of blaCMY-2 with the accession number Nos. EU1132222.1, EU1132220.1, AB3658670.1.
4. Discussion
Three major plasmid-mediated quinolone resistance and
Table 1. Information about antimicrobial agents, MIC range and antimicrobial resistance percentage for 85 samples of Salmonella isolates obtained from stool, blood, bone marrow, synovial fluid, abscess, urine.
expended spectrum Cephalosporins were studied. Although resistance to quinolone and flouroquinolone with qnr gene is rare, most of the qnrA positive clinical isolates were found to have high level quinolone resistance in the present study which was usually detected by resistance to Nalidixic acid. The ability of these genes to supplement resistance is due to mutation in DNA gyrase and topoisomerase IV, porin or efflux mutations and qnrB seems to be even more potent than QnrA in blocking the action of Ciprofloxacin. These data show that qnrA presents a potential problem for the spread of quinolone resistance. Spread of these gene and bla gene is depending on the geographical region. The high prevalence of qnr among Salmonella spp. isolates and extended spectrum Cephalosporin-resistant or ESBL producing isolates has also been described in several countries. For example, the qnrB gene has been found in Senegal, USA and Korea, while the qnrS gene has been found in Enterobacteriacea in Germany, USA, Taiwan, Vietnam, France, Sothern and eastern Asia, North and south American, Europe and blaCMY has been reported in France, Turkey, Greek, USA, Mexico and United Kingdom [8,12,18,19]. Cephalosporins resistance is quite important due to its rapid spread not only among clinical isolates but also among Community in other countries [20]. The frequent association of qnr resistance gene with bla has been noted in several studies. It is Noteworthy that perception of qnrA, qnrB, qnrS in the overall quinolone and flouroquinolone was noticeable. Nonetheless, association between qnr and blaCMY was more important [10]. In both India and United States qnrB has been found on plasmid that encoding blaESBL, CTX-M-15 in India and SHV-12 in United States [13]. The presence of qnr and
Table 2. The information of BlaCMY-2 and qnrA, qnrB, qnrS positive in Salmonella spp.
bla genes on the same plasmid is one of the several possible explanations. In this study, qnrA gene coresistance with blaCMY in some isolates may be on the same plasmid. qnrA was as common as blaCMY in these community but there is no qnr gene with ESBL in the same isolates. The similar results were acquired at Turkey in 2008 [20]. All our qnr positive isolates couldn’t carry blaCMY-2. The qnrA gene was more prevalent than the qnrB and qnrs. In 85 clinical isolates of Salmonella, 57.6% of isolates were resistant to quinolone, 38.82% to Cephalosporins and 14.1% to ampicillin. If the plasmids carrying both the qnrA and blaCMY genes spread rapidly, an important ally like the quinolone could be lost in the near future. Exploration about the events leads to co resistance of quinolone and extended spectrum Cephalosporins. In another study, we have shown that class 2 integron carrying gene cassettes which confer resistance to different classes of antibiotics such as Aminoglycosides and Trimethoprim are prevalent in Salmonella serovars isolated in Iran [21]. Presence of plasmid-mediated resistance, as well as association of class 2 integron, in Salmonella serovars demonstrates that antimicrobial selection pressure is widespread in our clinical settings. Regarding this issue and to avoid distribution of multidrug resistance, the limited use of antibiotics in clinics would be recommended.
Authors’ Contributions
This work was carried out in collaboration between all authors. Authors Raheleh Saboohi and Seyed Davar Siadat with the same contributions, designed the study, managed the literature searches, performed the analysis of data and wrote the first draft of the manuscript. All authors read and approved the final manuscript.
Acknowledgements
This study is supported by Pasteur Institute of Iran. Kind cooperation of my colleagues in Department of Microbiology, Pasteur Institute of Iran, is highly appreciated. Special thanks to Dr. Seyed Mehdi Sadat, Mr. Alireza Azizi and Amin Arsang.
NOTES