P53 pseudogene: potential role in heat shock induced apoptosis in a rat histiocytoma

doi:10.4236/health.2010.29156

Paper Menu >>

Journal Menu >>

Vol.2, No.9, 1065-1071 (2010) Health

doi:10.4236/health.2010.29156

P53 pseudogene: potential role in heat shock induced

apoptosis in a rat histiocytoma

Amere Subbarao Sreedhar

Centre for Cellular and Molecular Biology, Hyderabad, India; assr@ccmb.res.in

Received 1 June 2010; revised 2 July 2010; accepted 5 July 2010.

ABSTRACT

The p53 tumor suppressor gene is either non-

functional or highly and frequently mutated in

majority of cancers. In our study towards un-

derstanding cellular adaptations to stress using

a rat histiocytic tumor model, we have identified

mis-sense mutation in p53 that led to premature

termination of translation at the carboxyl-termi-

nus. Further, the cDNA isolated from heat stre-

ssed cells producing two amplicons with cDNA

specific primers (N-terminus) suggested oc-

currence of possible pseudogene(s). A com-

parative analysis between different tumor cell

lines of rat origin and rat genomic DNA using

p53 gene specific primers resulted in the ampli-

fication of a processed pseudogene and its

positive interaction with wild type p53 probe on

Southern blot analysis. The genomic DNA se-

quence analysis, and sequence comparison

with cDNA discovered that the processed pseu-

dogene lacks DNA binding domain and nuclear

localization signal, however, contains the ribo-

somal entry and stop signals. Rat genome

BLAST analysis of the pesudogene suggested

chromosome-18 localization which was in addi-

tion to 14, 13, 10, 9 localization of the cDNA. In

the interest of unraveling hidden dimensions of

p53 tumor suppressor gene, our study explores

the probability of p53 functional pseudogenes in

rat histiocytoma.

Keywords: Pseudogene; P53; Tumor; Rat

Histiocytoma

1. INTRODUCTION

The tumor suppressor p53 is a multifunctional protein

that is involved in a variety of biological processes such

as growth arrest, apoptosis, differentiation and senes-

cence [1,2]. Aberrant expression of this gene results in

either a gain of transforming potential or a loss in tumor

suppressor activity [3,4]. The p53 gene mutation, dele-

tion, insertion or protein sequestration etc are often

found in many cancers [5,6] and these mutations affect

the p53 binding to DNA [7]. Analysis of the degeneracy

of p53 DNA-binding site suggests that there may be as

many as 200-400 p53 target sequences or perhaps more

[8]. Despite the high frequency with which p53 is mutated

during tumor development, a substantial proportion of

tumors still express the wild type p53 [9]. This could be

the reason in spite of exhaustive information on p53 modi-

fications the corresponding role of p53 modification in

experimental animal tumor models is poorly understood.

We are investigating the role of p53 in heat stress-in-

duced rat histiocytic tumors models. In the process of

elucidating heat stress induced cell death pathways and

evaluating the functional significance of p53 in heat

shock induced cell death in tumor cells, we have identi-

fied mutated form of p53 with two functional alleles by

reverse transcriptase polymerase chain reaction, and the

deletion and addition of nucleotides had resulted in

C-terminal deletion of 50 amino acids. We demonstrated

that Fas/CD95 induced apoptosis requires p53, and hy-

pothesized that C-terminal deletion and loss of oligo-

merization domain and nuclear localization signal proba-

bly are responsible for p53-transcritpion independent

apoptosis as suggested [10,11]. In the present study we

show that there are two processed pseudogenes for p53

in this tumor model and one of them also has ribosomal

entry site. A comparative genome analysis further re-

vealed that the processed pseudogene is predominantly

present in all the rat and mouse species but absent in

humans.

2. MATERIALS AND METHODS

2.1. Animal Handling

All animal maintenance and handling was accomplished

as per the institutional ethical committee approval at

Centre for Cellular and Molecular Biology, Hyderabad,

India.

A. S. Sreedhar / HEALTH 2 (2010) 1065-1071

1066

2.2. Tumor Growth and Cell Culture

Maintenance

AK-5 tumor cell line is established from i.p injections of

cell-free ascites fluid of a chemically induced and estab-

lished rat liver tumor, Zajdela ascetic hepatoma (ZAH).

These cells possess typical characteristics of macro-

phages. Single clone of AK-5 tumor, called BC8, was

adapted to grow in culture for several generations in

Dulbecco’s Modified Eagle’s Medium (DMEM) with

10% heat inactivated fetal calf serum (FCS) in the pres-

ence of penicillin (100 U/ml) and streptomycin (50

g/ml) is used in the present study. Rat fibroblasts (F111)

was procured from ATCC and maintained similar to BC8

as mentioned above. BC-8 cells (8 × 106 cells) were used

for injection either for s.c. or i.p. of six-week-old naïve

male Wistar rats and tumor growth was monitored. The

i.p tumor development approximated by the mean total

cell mass calculated from the percentage of packed cells

and the total ascites weight.

2.3. Genomic DNA Isolation

For normal rat live genomic DNA, six month old male

Wistar Rat was scarified as per institutional animal eth-

ics recommendations and genomic DNA was isolated

from the liver by phenol: chloroform method and used in

the present experiment.

2.4. RNA Isolation and cDNA Library

Construction

The control and heat stressed tumor cells are subjected

to single step total RNA isolation using Trisol reagent,

the integrity of RNA was examined by 1% agarose gel,

and 5 µg total RNA was used for cDNA preparation by

reverse transcriptase system containing the MMLV re-

verse transcriptase enzyme and oligo d(T) primer and the

cDNA prepared was used for further experiments.

2.5. Primers Used for the Polymerase Chain

Reaction

PCR primers were designed for the cDNA clone span-

ning the coding sequence of rat wild type p53 (Acc. No.

X13058). Four sets of primers for the amplification of

full length as well as partial cDNA amplification were

made and used in the present study (Figure 1(a)). Primer

set II, P1: Forward-5’ atggatccatggaggattcacagtcg 3’, P2:

Reverse-5’ atgaattcgcacagggcatggtcttc 3’; Primer Set III,

P3: Forward-5’ atggatcctctgccagctggcgaagacat 3’, P4:

Reverse-5’ atgaattcggacaggcacaaacacga 3’; Primer Set

IV, P5: Forward-5’atggatcctgaggttcgtgtttgtgc 3’, P6:

Reverse-5’ atgaattctgtcagtctgagtcaggc 3’; and the Primer

set I is the combination of primers P1 and P6. Care has

been taken while designing the PCR primes to have 50%

GC content. The PCR conditions are as follows, 94˚C—

1 min followed by 94˚C—1 min, 55˚C—1 min, 72˚C—1

min × 30 cycles unless otherwise indicated.

2.6. Southern Blot Analysis

The full length wild type p53 cDNA (1.2 kb) was radio-

labeled using 32P-dATP by random primer labeling.

Hundred nanograms of the template DNA was incubated

IIIIIIIVVVIVII VIIIIXXXI

II   IIIIVVTA PRD

DBD

OD ND

1‐100 101‐300 301‐393

P1 P3P5

P2P4 P6

forward

reverse

P1 P3P5

P2P4 P6

forward

reverse

ami noacids

NLS(316‐325)DBD(100‐300)

(a)

(b)

(c)

Figure 1. Structural organization of p53. (a) Genome organization depicting the exons of p53 and indicating

the primers P1-P6 matching regions; (b) Schematic representation of coding region (cDNA) indicating prim-

ers P1-P6; (c) Functional domains showing the conserved regions of p53, appropriate amino acid lengths

(1-393) are mentioned. DBD: DNA binding region; NLS: nuclear localization signal.

A. S. Sreedhar / HEALTH 2 (2010) 1065-1071

1067

(37˚C, 15 min) with dNTPs exempting dATP and in the

presence of 10 µci of 32P-dATP, random primer, Klenow

enzyme (5 U) and reaction buffer. After the reaction, la-

beled template was purified through sephadex G-50 col-

umn, probe containing 1 × 108 µci per microgram DNA

was used for hybridization. PCR amplicons first run on

1% agarose gels were vacuum transferred to N+ nylon

membrane (Amersham), UV cross-linked and hybridized

with radiolabeled probe for overnight. Blots were washed

under stringent conditions (sodium phosphate buffer +

SDS) and exposed to X-ray film, and photographed.

2.7. Cloning and Sequence Characterization

The PCR amplicons are purified using PCR Wizard puri-

fication system (Promega, USA) either cloned in TOPO

cloning vector and or taken to automated DNA sequence

analysis (Model 3730, M/s Applied Biosystems, USA).

The obtained DNA sequences were subjected to blast

analysis (Entrez at http://www.ncbi. nlm.nih.gov) and the

deduced amino acid sequences were analyzed at h t tp://

www.expasy.ch, and http://www. isrec.isb-sib.ch.

3. RESULTS

3.1. Heat Stress Induces p53 Transcription

In continuation of our interest to know the functional

significance of p53 in rat histiocytic tumor models, we

compared control cells with heat stress and found that

heat stress enhanced p53 transcription (Figure 2(a)).

Interestingly when heat stressed samples were sub-

jected for partial PCR analysis we found that primer set

II gave two prominent amplicons, while primer sets III

and IV giving single amplicon (Figure 2(b)). The PCR

amplicons obtained by all the primer sets were excised

from agarose gel, purified using PCR product purifica-

tion kit (PCR Wizard, Qiagen) and re-amplified using

same set of primers. All the amplicons showed signifi-

cant re-amplification suggesting that these amplicons

are p53 gene specific (Figure 2(c)). However to con-

firm and avoid ambiguity with p53 sequence specificity,

all the products hybridized with wild type radio labeled

p53. Except the lower band of the amplicon with

primer set II, all other amplicons showed signficant

binding to the radiolabeled probe (Figure 2(d)). The

amplicons were cloned in TA cloning vector (Promega)

and subjected to automated DNA sequencing. The se-

quences obtained were aligned with wild type p53

cDNA sequence and found to be homologous (data not

shown). While full length did not show any duplication,

only primer set II showing such amplicon suggested

presence of possible pseudogenes.

3.2. BC8 Genome Contains a Processed

Pseudogene

In addition to the two alleles reported [10] the additional

amplicons obtained may be related to processed p53

alleles originating from the genomic DNA. Therefore the

genomic DNA from the tumor cells was isolated and

subjected to genomic PCR using p53 cDNA specific

primer sets I, II, III, and IV. While primer sets I, II, and

IV were giving a single amplicon, primer set III did not

yield any amplification (Figure 3(a)). Genomic southern

however identified only the full length amplicon ampli-

fied using the primer set I (Figure 3(b)). These results

therefore suggested a processed pseudogene of p53 in

these tumor cells.

rathistiocytom a(BC8) ratlivercells

primerset

rathistiocytom a(BC8)

‐heatshock‐

28S

18S

p53

RNA Southernanalysis

(a)

(b)

(c)

(d)

Figure 2. Reverse transcription and polymerase chain reaction. (a) The total RNA from control and heat shocked

BC8 tumor cells was isolated and subjected to RT-PCR analysis with primer set I. The RNA loading control was

also shown with intact 28S and 18S RNA; (b) The cDNA of heat shocked BC8 cells was used as a template to am-

plify p53 with primer sets II, III, and IV. Note only the primer set II showing two amplicons; (c) Re-amplification of

first round PCR products after gel elution with appropriate primer sets mentioned; (d) Southern blot analysis of

re-amplified PCR products.

A. S. Sreedhar / HEALTH 2 (2010) 1065-1071

1068

rathistiocytoma(BC8) ratascites(AK5)ratfibroblasts(F111) ratliverce lls

primerset

(a) (b )

Southern analysis

Figure 3. Genomic PCR and Southern analysis. (a) BC8 genomic PCR analysis with four primer sets, I, II, III, and IV; (b)

Genomic Southern analysis of PCR products obtained from Figure 3(a); (c) Genomic PCR analysis of rat fibroblasts, rat

histiocytoma (AK5), and rat liver cell; (d) Genomic Southern analysis of PCR products obtained from Figure 3(c).

Processed pseudogenes arise through a mechanism

whereby a spliced mRNA is reverse transcribed and sub-

sequently inserted into the genome [12]. If pseudo-

genes are formed in this way during evolution, these

pseudogenes should present in the rat genome and

should coexist with all the cell types. To examine this,

transformed rat fibroblast cells (F111), parental ascites

rat histiocytoma (AK5) were compared with the normal

rat genomic DNA.

3.3. Blast and In-Silico Translational Analysis

We went ahead of cloning p53 pseudogene and se-

quence alaysis of cloned product using automated

DNA sequencing. From the sequence analysis we

found that there is indeed a processed pseudogene

having a potential to provide two gene products with

different reading frames. A comparative sequence alig-

nment of processed pseudogene with full length RT-

PCR product of rat histiocytoma additionally showed

high sequence homology. Analysis of pseudogene re-

vealed loss of DNA binding region (nt 700-860) and

nuclear localization signal (nt 1030-1080) of cDNA

(Figure 4). Whole rat genome Blast analysis with

cDNA sequence identified its chromosome localization

on chromosomes 14, 13, 10, 9 and 2, and the pseu-

dogene sequence Blast identified its additional local-

ization at chromosome 18 (Table 1).

4. DISCUSSION

The p53 gene is frequently lost or rearranged in a large

variety of cancers, and most of the alterations in p53 are

found in the core domain that interfere with p53 DNA-

binding activity [5]. Although p53 has been a wonder

molecule and the guardian of genome, mutation of p53

affects its native functions including the antiapoptotic

function. Several p53 mutant cells are reported to have

lost apoptotic functions but not the cell cycle inhibition

[13,14]. While our earlier study suggesting that loss of

C-terminal 50 amino acids could have played a role in

p53-transcription independent apoptosis via Fas/CD95

translocation from golgi to plasma membrane [11,15], a

report from Zhu et al. [16] indicated that the N-terminal

43-63 amino acid are more than sufficient to activate

p53 transcription dependent apoptosis. Further, induction

of pro-apoptotic factor Bax, a known transcriptional cli-

ent for p53 [17], and subsequent activation of intrinsic

apoptotic death pathway through mitochondrial dysfunc-

tion [18] directed us to look for possible processed genes

in the tumor genome.

By definition, pseudogenes lack a function. However,

the classification of pseudogenes generally relies on

computational analysis of genomic sequences using

complex algorithms [19]. It has been established that

quite a few pseudogenes can go through the process of

A. S. Sreedhar / HEALTH 2 (2010) 1065-1071

1069

transcription, either if their own promoter is still intact or

in some cases using the promoter of a nearby gene; this

expression of pseudogenes also appears to be tis-

sue-specific [20]. Pseudogenes are often referred to in

the scientific literature as nonfunctional DNA. Failure to

observe pseudogenes coding for a product under ex-

perimental conditions is no proof that they never do so

inside an organism. Homologous recombination between

the intact functional p53 gene and the p53 pseudogene is

thought to have occurred in such a perturbed intracellu-

lar environment with genomic instability, thus inactivat-

ing the intact allele of the functional p53, therefore the

persistence of pseudogenes is in itself additional evi-

dence for their activity. Natural selection would remove

p53 cDNAvs. Pseudogene

Figure 4. Blast analysis of p53 cDNA and pseudogenes showing the loss of DNA binding domain (DBD) and nuclear localization

signal (NLS) in the pseudogene.

A. S. Sreedhar / HEALTH 2 (2010) 1065-1071

1070

Table 1. Genome blast analysis showing the chromosome localization of cDNA and pseudogenes.

S. No. Accession number chromosome E value % identity

cDNA NW 047430.2

NW 001084694.1 14 0.0 84

NW 047390.2

NW 001084680.1 13 0.0 78

NW 047334.2

NW 0010884656.1 10 1e-140 100

NW 047813.2

NW 001084694.1 9 0.0 84

NW 047627.2

NW 001084680.1 2 0.0 87

pseudogene NW 047518.2

NW 001084740.1 18 0.0 99

NW 047430.2

NW 001083694.1 14 0.0 84

NW 047390.2

NW 001084680.1 13 3e-23 76

NW 047334.2

NW 001084656.1 10 1e-42 81

NW 47813.2

NW 001084880.1 9 5e-86 95

this type of DNA if it were useless, since DNA manu-

factured by the cell is energetically costly. As the func-

tion of more pseudogenes is being uncovered by testable

and repeatable science, it is evident that these genetic

elements, which are copiously spread in the genomes of

different organisms, have been created with purpose.

In addition, and in contrast to previously believed in-

formation that pseudogenes are non functional copies of

genes [21,22], growing evidence suggests that at least

some pseudogenes are functional. It has been demon-

strated that pseudogenes notably arise from seemingly

absent or disabled promoters, premature stop codons,

splicing errors, frameshift-causing deletions and inser-

tions, etc., and do not necessarily abolish gene expres-

sion [23,24]. McCarrey et al. [25] have suggested that

pseudogenes can be functional in terms of the regulation

of the expression of its paralogous genes, otherwise an-

tisense to pseudogenes should not interfere with cellular

functions. In support of this earlier we have used N-

terminal siRNA to p53 and could inhibit its functions

[10]. With respect to the evolution of regulatory func-

tions of pseudogenes we must now conclude that tran-

scribed pseudogenes are not necessarily without function.

Indeed, they would appear to be especially suited to

roles involving the antisense regulation of the active

genes to which they are related [24]. In summary we

report a processed pseudogene and additional transla-

tional products for p53 in a rat histiocytoma that differ

from the parental tumor and from the rat genome may

have function roles upon stress and tumorigenesis.

REFERENCES

[1] Green, D.R. and Kroemer, G. (2009) Cytoplasmic func-

tions of the tumour suppressor p53. Nature, 458(7242),

1127-1130.

[2] Darzynkiewicz, Z. (1995) Apoptosis in antitumor strate-

gies: modulation of cell cycle or differentiation. Journal

of Cellular Biochemistry, 58(2), 151-159.

[3] Halevy, O., Michalovitz, D. and Oren, M. (1990) Differ-

ent tumor-derived p53 mutants exhibit distinct biological

activities. Science, 250(4977), 113-116.

[4] Michalovitz, D., Halevy, O. and Oren, M. (1991) P53

mutations—gains or losses. Journal of Cellular Bio-

chemistry, 45(1), 22-29.

[5] Levine, A.J. (1997) P53, the cellular gatekeeper of growth

and division. Cell, 88(3), 323-331.

[6] Weghorst, C.M., Buzard, G.S., Calvert, R.J., Hulla, J.E.

and Rice, J.M. (1995) Cloning and sequence of a proc-

essed p53 pseudogene from rat: A potential source of false

‘mutations’ in PCR fragments of tumor DNA. Gene,

166(2), 317-322.

[7] de Fromentel, C.C. and Soussi, T. (1992) TP53 Tumor

suppressor gene: A model for investigating human

mutagenesis. Genes Chromosomes and Cancer, 4(1), 1-

15.

[8] El-Deiry, W.S., Kern, S.E., Pietenpol, J.A., Kinzler, K.W.

and Vogelstein, B. (2002) Definition of a consensus

binding site for p53. Nature Genetics, 1(1), 45-49.

A. S. Sreedhar / HEALTH 2 (2010) 1065-1071

1071

[9] Blagosklonny, M.V. and El-Deiry, W.S. (1998) Acute

overexpression of wt p53 facilitates anticancer drug-

induced death of cancer and normal cells. International

Journal of Cancer, 75(6), 933-940.

[10] Sreedhar, A.S., Pardhasaradhi, B.V.V., Khar A. and Srini-

vas, U.K. (2002) Effect of C-terminal deletion of P53 on

heat induced CD95 expression and apoptosis in a rat

histiocytoma. Oncogene, 21(25), 4042-4049.

[11] Bennett, M., Macdonald, K., Chan, S.W., Luzio, J.P.,

Simari, R. and Weissberg, P. (1998) Cell surface traf-

ficking of Fas: A rapid mechanism of p53-mediated

apoptosis. Science, 282(5387), 290-293.

[12] Lewin, B. (1990) Structural genes evolve in families. In:

Genes IV, Oxford University Press, New York, 497-517.

[13] Rowan, S., Ludwig, R.L., Haupt, Y., Bates, S., Lu, X.,

Oren, M. and Vousden, K.H. (1996) Specific loss of

apoptotic but not cell-cycle arrest function in a human

tumor derived p53 mutant. EMBO Journal, 15(4), 827-

838.

[14] Ryan, K.M. and Vousden, K.H. (1998) Characterization

of structural p53 mutants which show selective defects in

apoptosis but not cell cycle arrest. Molecular Cell Biology,

18(7), 3692-3698.

[15] Sreedhar, A.S., Pardhasaradhi, B.V.V., Khar, A. and

Srinivas, U.K. (2000) Heat induced expression of CD95

and its correlation with the activation of apoptosis upon

heat shock in rat histiocytic tumor cells. FEBS Letters,

472(2-3), 271-275.

[16] Zhu, J., Zhou, W., Jiang, J. and Chen, X. (1998) Identi-

fication of a novel p53 functional domain that is necessary

for mediating apoptosis. Journal of Cellular Biochemistry,

273(21), 13030-13036.

[17] Miyashita, T. and Reed, J.C. (1995) Tumor suppressor

p53 is a direct transcriptional activator of the human bax

gene. Cell, 80(2), 293-299.

[18] Sreedhar, A.S., Pardhasaradhi, B.V.V., Khar, A. and

Srinivas, U.K. (2002) A cross talk between cellular sig-

nalling and cellular redox state during heat-induced

apoptosis in a rat histiocytoma. Free Radical Biology and

Medicine, 32(3), 221-227.

[19] Harrison, P.M., Zheng, D., Zhang, Z., Carriero, N. and

Gerstein, M. (2005) Transcribed processed pseudogenes

in the human genome: An intermediate form of ex-

pressed retrosequence lacking protein-coding ability.

Nucleic Acids Research, 33(8), 2374-2383.

[20] Zheng, D., Frankish, A., Baertsch, R., Kapranov, P., Rey-

mond, A., Choo, S.W., Lu, Y., Denoeud, F., Antonarakis,

S.E., Snyder, M., Ruan, Y., Wei, C.L., Gingeras, T.R.,

Guigó, R., Harrow, J. and Gerstein, M.B. (2007) Pseu-

dogenes in the ENCODE regions: Consensus annotation,

analysis of transcription, and evolution. Genome Research,

17(6), 839-8351.

[21] Zhang, Z.D., Frankish, A., Hunt, T., Harrow, J. and Ger-

stein, M. (2010) Identification and analysis of unitary

pseudogenes: Historic and contemporary gene losses in

humans and other primates. Genome Biology, 11(3), R26.

[22] Torrents, D., Suyama, M., Zdobnov, E. and Bork, P. (2003)

A genome-wide survey of human pseudogenes. Genome

Research, 13(12), 2559-2567.

[23] Woodmorappe, J. (2003) The potential immunological

functions of pseudogenes and other ‘junk’ DNA. Journal

of Creation, 17(3), 102-108.

[24] Woodmorappe, J. (2003) Pseudogene function: Regulation

of gene expression. Journal of Creation, 17(1), 47-52.