Aronia melamocarpa (AM) is a rich source of anthocyanins, which are known to help prevent obesity. The cyanidine-3-O-galactoside enriched AM extract (AM-Ex) containing more cyanidine-3-O-galactoside than conventional AM extract was recently developed. The objective of this study was to examine the effect of AM-Ex on adipogenesis and its action mechanisms in vitro using 3T3-L1 adipocytes. To examine the anti-obesity effect of AM-Ex, 3T3-L1 cells were induced adipocyte differentiation and incubated with various concentration of AM-Ex. Lipid accumulation, cellular triglyceride content, mRNA expression of transcription factors and adipogenic genes were analyzed. Treatment with 100 - 400 μg/mL of AM-Ex resulted in a dose-dependent decrease in adipocyte differentiation and triglyceride accumulation. mRNA expression of adipogenic transcription factors, such as peroxisome proliferator-activated receptor gamma, CCAAT/enhancer binding protein α, sterol regulatory element-binding protein 1 were decreased. The level of gene expression of adipogenesis and lipogenesis-related genes, such as adipocyte protein 2, lipoprotein lipase, acetyl-CoA carboxylase, ATP-citrate lyase and fatty acid synthase were decreased. These results suggest that AM-Ex alleviated risk factors related to obesity by modulating multiple pathways associated with adipogenesis.
The prevalence of obesity has increased dramatically worldwide and has become a major global health problem. Obesity is related to increased mortality and morbidity in a number of chronic diseases, such as metabolic syndrome and vascular disease [
Various drugs have been developed and applied to treat obesity through regulating appetite and controlling fat absorption and oxidation. However, these anti-obesity drugs have been reported to cause negative side effects and rebound weight gain when the medication was ceased [
Aronia melamocarpa (AM), known as aronia or chokeberry, belongs to the Rosaceae family, and originated in North America. Its red-purple fruits are frequently made into juice or jams. Also, it has traditionally been used in Russia and some Eastern European countries to treat chronic diseases [
Adipogenesis is constituted by a set of processes, which include preadipocyte proliferation, differentiation, and fatty acid synthesis, and is regulated by various molecular factors. Adipogenesis is related to both the occurrence and development of obesity [
Recently, we developed a new kind of C-3-Gal enriched AM extract (AM-Ex), containing more C-3-Gals than conventional AM extract. In the present study, we investigated the effect of AM-Ex on adipogenesis and its action mechanisms in vitro using 3T3-L1 adipocytes in order to elucidte the anti-obesity of AM-Ex.
The materials used in this study were purchased from the indicated suppliers: Dulbecco’s Modified Eagle’s Medium (DMEM) and other miscellaneous cell culture reagents from Welgene (Daegu, Korea); fetal bovine serum (FBS) and bovine calf serum (BCS) Gibco-Thermo Fisher Scientific Inc. (Waltham, MA, USA); 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT), 3-isobutyl-1-methylxanthine, dexamethasone, insulin, and Oil red O from Sigma-Aldrich Co. (St. Louis, MO, USA); and cyanidine-3-O-galactoside (C-3-Gal) from Polyphenols AS (Sandnes, Norway). Unless noted otherwise, all other materials were purchased from Sigma-Aldrich Co.
The freeze-dried powder of Aronia melanocarpa Nero fruits harvested from Goseong (Korea) was purchased from Goseong Happy Aronia Farm (Goseong, Korea). The dried fruit powder was extracted with 70% ethanol by adding 100 g of the dried powder to 2 L of 70% ethanol using a high pressure homogenizer (Micronox, Seongnam, Korea) at room temperature. The intermediate extract was additionally extracted under reduced pressure using a rotary evaporator at 40 Mpa pressure at 30˚C for 2 h. The extract was concentrated with a rotary evaporator, and lyophilized for 72 h in a lyophilizer (IlshinBioBase, Dongducheon, Korea). The resulting powder was used as Aronia melanocarpa Nero extract (AM-Ex) and stored at −20˚C until further use. The control 70% ethanol extract (C-AM-Ex) was extracted for 24 h at 80˚C from 100 g of the dried fruit powder placed into 2 L of 70% ethanol. This C-AM-Ex was concentrated with a rotary evaporator, and lyophilized for 72 h in a lyophilizer (IlshinBioBase).
Both AM-Ex and C-AM-Ex were analyzed using HPLC (Ultimate 3000, Thermo Fisher Scientific, Waltham, MA, USA) with Jupiter 5 μ C18 columns (150 × 4.6 mm, 3000 A, Phenomenex, Torrance, CA, USA) at 520 nm, and the operating conditions were as follows. The mobile phase solvents used were (A) HCOOH-H2O (1:9) and (B) HCOOH-MeOH-H2O (1:5:4), with (A) 100% in the 0 - 2 min period, with (A) 30% and (B) 70% in the 2 - 20 min period, with (B) 100% in the 20 - 22 min period, and with (A) 100% in the 22 - 24 min period. Before performing HPLC, the samples were filter using 0.45 μm filter, and the flow velocity was set to 0.8 mL/min.
Mouse 3T3-L1 preadipocytes were purchased from the Korean Cell Line Bank (Seoul, Korea). 3T3-L1 cells were cultured in growth medium (GM; DMEM supplemented with 100 mL/L BCS, 100,000 U/L penicillin, and 100 mg/L streptomycin) at 37˚C in a humidified atmosphere of 5% CO2 and 95% air. To induce adipocyte differentiation, at 2 days post-confluence (referred to as day 0), 3T3-L1 cells were exposed to differentiation medium (DM; DMEM with 100 mL/L FBS, containing 0.5 mM 3-isobutyl-1-methylxanthine, 1 μM dexamethasone, and 5 μg/mL insulin) for 2 days. On day 2, the medium was replaced with DM (DMEM with 100 mL/L FBS, containing 5 μg/mL insulin only). On day 4, the medium was replaced with DMEM supplemented with 100 mL/L FBS and cells were incubated for the next 4 - 8 days to fully differentiate. To examine the effects of AM-Ex on adipocyte differentiation, the cells were incubated in D-M in the presence or absence of various concentration of AM-Ex at 2 day intervals when the medium was replenished.
Cell viability was determined by the MTT assay, as described previously [
3T3-L1 cells were induced differentiation and treated with various concentration of AM-Ex as described above. Eight days after induction of differentiation and treatment, the fully differentiated 3T3-L1 cells were fixed using 4% paraformaldehyde in phosphate buffered saline (PBS) for 1 h, washed with PBS, then stained with Oil red O solution for 1 h. After removing excess staining solution, the stained cells were rinsed with water and dried. The stained cells were visualized by light microscopy (AxioImager, Carl Zeiss, Jena, Germany). Intracellular lipid accumulation was analyzed by dissolving the stained lipid droplets in 100% isopropanol and measuring the absorbance at 520 nm.
Following differentiation and treatment with AM-Ex, total lipids in cells were extracted, according to the conventional extraction method [
Eight days after induction of differentiation and treatment with AM-Ex, total RNA was isolated with the RNeasy kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s instruction. The content and purity of total RNA were estimated using a micro-volume spectrophotometer (BioSpec-nano, Shimadzu, Kyoto, Japan). Complementary DNA was synthesized from 1 μg of total RNA and 1 μM of Oligo-dT primer using HyperScriptTM RT master mix (GeneAll Biotechnology, Seoul, Korea) according to the manufacturer’s instruction. Quantitative real-time polymerase chain reaction (PCR) was conducted using a Rotor-gene 3000 PCR (Corbett Research, Mortlake, Australia) and Rotor-GeneTM SYBR Green kit (Qiagen) according to the manufacturer’s instruction. The sequences of the primers used in this study are shown in
Primer | Sequence (5’ - 3’) | |
---|---|---|
ACC1 | Forward Reverse | GGAGATGTACGCTGACCGAGAA ACCCGACGCATGGTTTTCA |
ACL | Forward Reverse | TGGATGCCACAGCTGACTAC GGTTCAGCAAGGTCAGCTTC |
aP2 | Forward Reverse | GGATTTGGTCACCATCCGGT TTCACCTTCCTGTCGTCTGC |
C/EBP-α | Forward Reverse | TGGACAAGAACAGCAACGAGTAC GCAGTTGCCCATGGCCTTGAC |
FAS | Forward Reverse | AGGGGTCGACCTGGTCCTCA GCCATGCCCAGAGGGTGGTT |
LPL | Forward Reverse | CCAATGGAGGCACTTTCCA CACGTCTCCGAGTCCTCTCTCT |
PPAR-γ | Forward Reverse | CAAAACACCAGTGTGAATTA ACCATGGTAATTTCTTGTGA |
SREBP-1c | Forward Reverse | CACTTCTGGAGACATCGCAAAC ATGGTAGACAACAGCCGCATC |
GAPDH | Forward Reverse | CATCAAGAAGGTGGTGAAGCAGG CCACCACCCTGTTGCTGTAGCCA |
Results are presented as the mean ± SEM. Statistical analyses were performed using the Student’s t-test to test the differences between the undifferentiated group (GM―treated group) and the differentiated group (DM―treated group). Analysis of variance (ANOVA) test, followed by Duncan’s multiple comparison test was performed to determine whether AM-Ex has significant effects on the differentiated group. P < 0.05 was considered to be statistically significant.
HPLC chromatograms of AM-Ex and C-AM-Ex are shown in
To investigate the concentration of AM-Ex that was not cytotoxic, we determined the effect of AM-Ex on 3T3-L1 cell viability by conducting the MTT assay. Concentrations of AM-Ex between 500 to 2000 μg/mL showed significant reductions in the viability of 3T3-L1 cells. However, the viability of cells treated with lower doses of AM-Ex (1 to 400 μg/mL) were not significantly different compared to non-treated cells (
3T3-L1 preadipocytes undergo morphologic changes from a spindle-like to round shape and accumulate intracellular lipids after addition of differentiation inducing reagents [
in 3T3-L1 preadipocytes.
To investigate the effect of AM-Ex on lipogenesis, we determined intracellular triglyceride accumulation in 3T3-L1 adipocytes. AM-Ex at concentrations of 100, 200 or 400 μg/mL reduced the triglyceride levels in 3T3-L1 adipocytes by 24.4%, 28.6%, and 36.2%, respectively, compared to the non-AM-Ex-treated control (
Adipogenesis is the process by which the differentiation from preadipocytes to mature adipocytes occurs. Several transcription factors such as CCAAT/enhancer binding proteins (C/EBPs), peroxisome proliferator-activated receptorγ (PPARγ) and sterol regulatory element-binding protein 1c (SREBP-1c) are involved in adipogenesis [
adipocyte differentiation and adipogenesis through down-regulation of transcription factor, including C/EBP-α, PPAR-γ, and SREBP-1c.
Adipogenic transcription factors, including C/EBP-α, PPAR-γ, and SREBP-1c, cooperatively induce the expression of specific genes involved in adipogenesis and lipogenesis [
mRNA expression of lipogenesis-related genes, including acetyl-CoA carboxylase 1 (ACC1), ATP-citrate lyase (ACL), and fatty acid synthase (FAS). However, there was no significant difference in the expression of ACC1, ACL, and FAS at AM-Ex concentrations of 100, 200, or 400 mg/mL (
Aronia melanocarpa (Chokeberry, AM) is a rich source of polyphenols, especially anthocyanins present as different forms of cyaniding-glycosides, procyanidins, and flavonoids. Numerous health promoting effects of AM, related to antioxidant activity have been reported [
Increased adipose tissue and adipocyte dysfunction related to obesity have been shown to be associated with abnormal adipogenesis regulation [
PPARγ and C/EBPα are crucial transcription factors in adipogenesis. PPAR is considered a critical factor in glucose and energy metabolism [
In the present study, we observed that AM-Ex treatment decreased PPARγ, C/EBPα, and SREBP1c mRNA expression in 3T3-L1 cells (
When adipose LPL is increased, free fatty acid produced by hydrolysis of lipoprotein stimulates PPAR transcription factor. In adipose tissue, LPL stimulates PPARγ and the LPL gene exhibits a mutually positive feedback loop that is stimulated by PPARγ [
Studies on the mechanism of the molecular regulation associated with the anti-obesity effects of AM have recently begun. Kowalska et al. [
Our results showed that the anti-obesity effect of AM-Ex occured through down-regulation of the transcription factors PPARγ, C/EBPα, SREBP-1c, and adipogenesis and lipogenesis-related genes, aP2, LPL, ACC1, ACL, and FAS. These results demonstrate that AM-Ex can be used as a preventive or therapeutic agent for obesity. Future, animal and human studies are needed to further investigate the mechanism and proper concentration of AM to be used as anti-obesity agents.
This research was supported by the Ministry of Trade, Industry & Energy (MOTIE), Korea Institute for Advancement of Technology (KIAT) through the Encouragement Program for the Industries of Economic Cooperation Region (P0000824).
The authors declare no conflicts of interest regarding the publication of this paper.
Lim, S.-M., Jung, J.I., Kim, N.Y., Bae, J.-S., Lee, H.S. and Kim, E.J. (2019) Cyanidine-3-O-Galactoside Enriched Aronia melanocarpa Extract Inhibits Adipogenesis and Lipogenesis via Down-Regulation of Adipogenic Transcription Factors and Their Target Genes in 3T3-L1 Cells. Food and Nutrition Sciences, 10, 128-147. https://doi.org/10.4236/fns.2019.102011