20-Hydroxyecdyone (20E), an active form of ecdysteroid, is the key hormone in insect growth and development. To date five P450 enzymes involved in the last four steps of ecdysteroid biosynthesis from ketodiol to 20E namely Spook (Spo), Phantom (Phm), Disembodied (Dib), Shadow (Sad) and Shade (Shd) related to ecdysteroid biosynthesis, are identified and the character of last four enzymes is well studied in Drosophila melanogaster, Bombyx mori and Manduca sexta. All of these genes are called Halloween genes. In this study, we extended these works to a major pest insect in agriculture in India, the cotton leafworm Spodoptera litura (Lepidoptera: Noctuidae). We identified the sequence of five Halloween genes partially and converted into amino acid sequences and then three of them were compared with a very near African species of Spodoptera, Spodoptera littoralis. The results suggest amino acid substitution in open reading frame of phantom, shade and disembodied protein in Spodoptera litura.
Halloween genes are a set of genes, Spook (Spo), Phantom (Phm), Disembodied (Dib), Shadow (Sad) and Shade (Shd) identified in Drosophila melanogaster that influence embryonic development. All the above genes code for cytochrome P450 enzymes. These are strongly implicated in the biosynthesis of ecdysone (E) from cholesterol (ecdysteroidogenic pathway). Ecdysteroids such as 20-hydroxyecdysone and ecdysone influence many of the important morphological, physiological, biochemical changes that occur during molting in insects. Identification and expression profile of Halloween genes involved in ecdysteroid biosynthesis in Spodoptera littoralis was studied by Iga et al. [
Spodoptera litura (Tobacco caterpillar) was cultured in the lab in special cylindrical mating chambers. The average life cycle of Spodoptera litura is 25 days and they need small place for mating. The young caterpillars from hatched eggs were fed with artificial diet in all the months except winter. The artificial diet was standardized in the lab. In winter they were fed with cabbage leaves. When they were transformed into adult moth, both the males and females were fed with dilute honey and kept in the mating chamber for mating. After 7 - 10 days, the female hatched plenty of eggs in small cut tissue paper kept inside the mating chamber. The hatched larvae were reared and allowed to feed in small petri-plate and were grown inside temperature maintained BOD.
Isolation of RNA: RNA was extracted from Spodoptera litura by using pure link RNA mini kit (Ambion) and first-strand cDNA was reverse transcribed using 1 µg of total RNA by Reverse aid first strand cDNA synthesis kit (Thermo-scientific) and further processed for Halloween gene amplification (
Gene name | Primer name | Primer sequence (5' - 3') | Targeted region (bp) |
---|---|---|---|
Spook (Spo) | Forward | TTGGCGGTCACTCTTCTGTC | 613 |
Reverse | TGGCGCAAATCTTCCAGACT | ||
Phantom (Phm) | Forward | ATCATCGATCGGCGACGAAA | 857 |
Reverse | TATGAAACGGTTGGCGGTGA | ||
Disembodied (Dib) | Forward | ATGGGAGTGGCAAGACACAG | 409 |
Reverse | TTAGCACTTTTCGGGCTGGT | ||
Shadow (Sad) | Forward | CAGTTTGTTTGGGGACGCAG | 1000 |
Reverse | ATCACCAGCAGCGATGACAA | ||
Shade (Shd) | Forward | ATTGTGCCTGGCTTCGATCA | 594 |
Reverse | TAGCCTGGCCAAGAAAGGTG |
The NCBI database was extensively searched and Spodoptera littoralis cytochrome P450 mRNA, complete cds for all the genes were obtained. Gene-specific primers used for amplification of the target genes were prepared by primer designing software available in NCBI. The sequence specificities of the primer sequence so designed were verified using the BLAST program available at the NCBI website (www.ncbi.nlm.nih.gov/BLAST/). The parameters chosen for the BLAST search include sequence database “blastn”. The primer sequence was also evaluated for various other characteristics like melting point, presence of secondary structure formations like hairpins and propensity for dimer formation using software available in internet, Oligonucleotide Properties Calculator (http://www.unc.edu/~cail/biotool/oligo/).
PCR: The PCRs were carried out using Taq DNA polymerase (Fermentas) with the following general conditions: 15 - 20 ng of genomic DNA was used in a 20 μl reaction with 5 U/μl of Taq DNA polymerase, 2.5 mM each dNTP mix and 10 Pm/μl l of each primer. For Spo and Phm, initial denaturation was at 94˚C for 5 min followed by 94˚C for 30 sec, 35 cycles, annealing at 55˚C for 45 sec, extension at 72˚C for 3 min and final extension was at 72˚C for 10 min. Similarly for Shd, Dib and Sad, initial denaturation was at 95˚C for 10 min followed by 95˚C for 15 sec, 45 cycles, annealing at 45˚C for 1 min, extension at 60˚C for 15 sec and final extension was at 72˚C for 15 sec.
The PCR products (5 μl) were resolved in 1.5% agarose gel which was run at 80 V for 45 minutes. Negative PCR control was also run with double distilled water instead of DNA to eliminate doubts. The amplified products were eluted from the gel and purified by gel purification kit before sending for sequencing. The sequencing both through forward and reverse primers were done by Sanger method through outsourcing.
Nucleotide sequences of 600 bp, 800 bp, 450 bp, 1100 bp, 600 bp region of the spook, phm, Dib, Sad, Shd respectively of Halloween genes were obtained, blasted against nr sequences in NCBI and confirmed to be halloween genes against Spodoptera littoralis, then annotated and submitted to NCBI and reported first time in Spodoptera litura. Protein sequences were obtained by ExPASy translational tool in both Spodoptera litura and Spodoptera littoralis. Open reading frame with maximum length was selected. The sequences for both Spodoptera litura and Spodoptera littoralis of phantom, shade and disembodied partial gene proteins were aligned in protein alignment tool, SIM alignment tool-ExPASy.
I got accession numbers for phantom and shade from NCBI. They are KP212132 and KP212133. The rest are in progress. The alignment results of the above mentioned three partial gene protein sequences are represented in
The alignment results indicate substitution of amino acids in Spodoptera littoralis vis Spodoptera litura.
In phantom gene protein, glutamine and proline in Spodoptera litura are replaced by proline and threonine respectively in Spodoptera littoralis. In shade gene protein, phenylalanine, lysine and iso-leucine in Spodoptera
Spodoptera litura | Gene protein | Spodoptera littoralis |
---|---|---|
Phantom | ||
Glutamine | Proline | |
Proline | Threonine | |
Shade | ||
Phenylalanine | Valine | |
Lysine | Glutamic acid | |
Iso-leucine | Serine | |
Disembodied | ||
Alanine | Valine | |
Valine | Aspartic acid | |
Arginine | Glycine |
litura are replaced by valine, glutamic acid and serine in Spodoptera littoralis. In disembodied gene protein, alanine, valine and arginine in Spodoptera litura are replaced by valine, aspartic acid and glycine in Spodoptera littoralis respectively.
I got amino-acid substitution in open reading frame which may lead to functional change in proteins and it indicates a change in conserved halloween gene proteins in very close related species of same genus Spodoptera. Halloween genes are known for their important function, ecdysteroid biosynthesis which is required in developmental pathway (metamorphosis) of insects. So the changed amino-acids in two species may indicate chan- ges in developmental pathway which is significant in evolutionary point of view. Though evolutional conservation in halloween genes with a high similarity was found in Lepidoptera by Masatoshi Iga et al., change in amino-acid signifies change in protein in very close species of Spodoptera.
Similar reports were obtained for accelerated rate of amino acid change in halloween gene proteins in different species of Drosophila [
There is also genetic evidence that phantom (Cyp306a1) has been the target of recent natural selection in the Drosophila melanogaster [
The corresponding author is thankful to DST for funding (DST FAST TRACK PROJECT), Dr. Biswajit Paul, Senior Scientist (Entomology Division, IARI) and Ms Prachi Yadav, Scientist (Genetics Division, IARI) for their support.