A specific and sensitive polymerase chain reaction (PCR) assay based on the internal transcribed spacer (ITS) region of rDNA sequences was developed to detect endophytic and phytopathogenic fungi from needles of the Japanese black pine, Pinus thunbergii. Sequences of the ITS regions of Lophodermium conigenum, Lecanosticta acicola, Pestalotiopsis neglecta, Rhizosphaera kalkhoffii, and Septorioides pini-thunbergii were compared, and each specific primer pair for these species was designed. First, the designed primer pairs were tested for their specificity to detect each species. A PCR product was amplified only each combination of species and its specific primer pair, confirming the specificity of the designed primer pairs. These primer pairs were also tested on DNA extracted from the needles of P. thunbergii. The PCR products were amplified not only in needles with lesions but also in healthy needles without symptoms. Furthermore, several endophytic and phytopathogenic fungi could be simultaneously detected from the same region in a needle. The PCR-mediated detection method developed in this study will be a valuable tool for the detection of the endophytic and phytopathogenic fungi, not only as a rapid diagnostic tool for early detection but also for monitoring variations in both the quality and quantity of the endophytic and phytopathogenic fungi in needles in Japanese black pines.
The Japanese black pine (Pinus thunbergii Parl.), an evergreen species, is distributed along the seacoasts of Japan and South Korea. In addition, the Japanese black pine has been planted not only along seacoasts as a windbreak (Zhu et al., 2012) and to prevent soil erosion due to its resistance to salt (Townsend & Kwolek, 1987) and various environmental stresses (Tsukahara et al., 1985) , but also in public parks and gardens due to its beautiful appearance and toughness. Japanese black pines have been popular in Japan as both garden trees and bonsai (Chan, 2014) . Many diseases of the Japanese black pine are known, such as Dothistroma needle blight caused by Dothistroma pini (Ito & Zinno, 1972; Ito et al., 1975) , brown spot needle blight caused by Lecanosticta acicola (teleomorph: Mycosphaerella dearnessii) (Suto & Ougi, 1998; Seo et al., 2012) , needle cast caused by Lophodermium spp. (Yamamoto et al., 1964; Sakuyama, 1993) , Pestalotia disease caused by Pestalotiopsis spp. (Takahashi & Kobayashi, 1998; Takahashi & Kobayashi, 1999) , Rhizosphaera needle blight caused by Rhizosphaera kalkhoffii (Tanaka & Chiba, 1971) , and sooty mold caused by Septorioides pini-thunbergii (synonym: Septoria pini-thunbergii) (Kaneko et al., 1989; Suto, 2000) . It is difficult to distinguish between the diseases mentioned above because the diseases usually begin with the early symptom of yellowing and they are similar to each other, although the late symptoms of the diseases differ in terms of their characteristics. On the other hand, some of the fungi mentioned above have been considered to be endophytic fungi in Pinus spp. (Yoo & Eom, 2012; Min et al., 2014; Qadri et al., 2014) . The identification and detection of both endophytic and phytopathogenic fungi relies upon their culture-based morphological characteristics and on biochemical approaches. These procedures are time-consuming and require extensive knowledge of fungal taxonomy. Recently, a variety of molecular tools have been used to differentiate among fungal species. Among these, species-specific polymerase chain reaction (PCR) has emerged as a powerful tool for the identification and detection of phytopathogenic fungi, such as root rot pathogen Rhizopycnis vagum (Ghignone et al., 2003) , collar rot pathogen Sclerotium rolfsii (Pravi et al., 2014) , chestnut blight pathogen Cryphonectria parasitica (Popov et al., 2010) , and pine needle pathogen Lophodermium spp. (Stenström & Ihrmark, 2005) . This paper reports the development of specific and rapid detection of endophytic and phytopathogenic fungi from the needles of Japanese black pines using PCR assay based on the internal transcribed spacer (ITS) region of rDNA sequences.
The needles of Japanese black pines with symptoms of disease were collected from the suburb around Shimane University, Matsue, Shimane Prefecture, Japan. We isolated endophytic and phytopathogenic fungi by two methods. The first, the surface sterilization method (Hata & Futai, 1995) , was used for isolation with minor modifi- cations. Needles were cut and dipped in 70% ethanol for 1 min, surface sterilized for 5 min in a solution of 10% sodium hypochlorite solution (Wako Pure Chemical Industries, Osaka, Japan), rinsed in sterilized distilled water twice, and then dried on sterilized filter paper. Surface-sterilized samples were placed on potato dextrose agar (PDA) plates containing chloramphenicol (20 μg/ml) and incubated at 26˚C ± 1˚C for 1 - 2 weeks. In another method, needles washed with tap water were put on wet filter paper in a plastic box and then incubated at 26˚C ± 1˚C in a growth chamber (LH-60FL3-DT, NK System, Osaka, Japan) for 1 to 3 weeks under a regime of 12 h of white light and 12 h of dark in order to form stroma of endophytic and phytopathogenic fungi on the needles. Spore masses formed on the needles were then picked up with a sterilized glass needle under a stereomicroscope (Goh, 1999; Choi et al., 1999) , placed on PDA plates containing chloramphenicol (20 μg/ml), and incubated at 26˚C ± 1˚C for 1-2 weeks.
The identity of the isolates was confirmed by sequencing of the rDNA ITS region. Fungal isolates were grown on PDA medium for 1 week at 26˚C ± 1˚C. Mycelia were scraped and harvested in 1.5-ml Eppendorf micro tubes. DNA extraction was carried out using a Nucleo Spin Plant II kit (Macherey-Nagel, Düren, Germany) following the manufacturer’s instructions, resuspended in 20 μl of TE buffer, and stored at −20˚C until use. The universal primers ITS1 (5’-TCCGTAGGTGAACCTGCGG-3’) and ITS4 (5’-TCCTCCGCTTATTGATATGC-3’) (White et al., 1990) were used to amplify the ITS-5.8S-ITS regions between the 18S and 28S nuclear rDNA. PCR reactions were performed using a Thermal Cycler GeneAtlas (Astec, Fukuoka Japan). The reaction mixture (100 μl) contained about 20 ng of the fungal genomic DNA, 0.5 μM of each primer, 0.2 mM of each dNTP, 1× reaction buffer (10 mM Tris-Cl, pH 8.3, 1.5 mM MgCl2, 50 mM KCl), and 2.5 U of Taq DNA polymerase (TaKaRa, Osaka, Japan). The amplification cycle consisted of an initial heat denaturation step at 94˚C for 2 min, followed by 25 cycles of 94˚C for 30 sec, 55˚C for 30 sec, and 72˚C for 30 sec, and a final extension at 72˚C for 10 min. The PCR products were electrophoresed in a 1% agarose gel in Tris-acetate-EDTA (TAE) buffer (40 mM Tris acetate, 1 mM EDTA, pH 8.3), stained with ethidium bromide, destained in distilled water, and visualized under UV light (302 nm, UVP M-15V, UVP, Upland, CA). The PCR products were then excised and purified using the NucleoSpin Gel and PCR Clean-up kit (Macherey- Nagel) following the manufacturer’s instructions. Sequencing reactions were performed using the BigDye® Terminator v3.1 Cycle Sequencing Kit (Life Technologies, Carlsbad, CA) according to the manufacturer’s instructions. The DNA sequence analysis was performed on an ABI PRISM 310 genetic analyzer (Applied Biosystems, Foster City, CA). A computer analysis of the DNA sequence datawas performed using GENETYX®- Mac (GENETYX, Tokyo, Japan). Comparisons between the DNA and the predicted aminoacid sequence as well as a phylogenetic analysis were carried out using the BLAST and CLUSTALW network programsat the DNA Data Bank of Japan (DDBJ, http://www.ddbj.nig.ac.jp).
Sequences of each ITS region were aligned using CLUSTALW network programs at the DDBJ. Each specific primer pair within the ITS region was selected manually for species-specific detection. PCR reactions were performed by a Thermal Cycler GeneAtlas (Astec). The reaction mixture (20 μl) contained 10 ng of the fungal genomic DNA, 0.5 μM of each primer, 0.2 mM each dNTP, 1× reaction buffer (10 mM Tris-Cl, pH 8.3, 1.5 mM MgCl2, 50 mM KCl), and 0.5 U of Taq DNA polymerase (TaKaRa). The amplification cycle consisted of an initial heat denaturation step at 94˚C for 2 min, followed by 25 cycles of 94˚C for 30 sec, 55˚C for 30 sec, and 72˚C for 30 sec; and a final extension at 72˚C for 10 min. PCR products were electrophoresed in a 1.5% agarose gel in TAE buffer, stained with ethidium bromide, destained in distilled water, and visualized under UV light (302 nm, UVP M-15V, UVP). An electrophoretogram was photographed using a gel documentation system (Print graph AE-6910FD, ATTO, Tokyo, Japan).
The needles of Japanese black pines with or without symptoms of disease were collected from the suburb around Shimane University, Matsue, Shimane Prefecture, Japan. A detached needle from the Japanese black pine was washed in distilled water in order to remove microbial adhesion on the needle surface. DNA extraction from the needle was carried out using the NucleoSpin Plant II kit (Macherey-Nagel), resuspended in 50 μl of TE buffer, and stored at −20˚C until use. The first PCR reactions were performed using primers ITS1 and ITS4 in order to amplify the ITS-5.8S-ITS rDNA fragment of the fungi as mentioned above. A second PCR reaction (nested PCR) was performed using each specific primer pair and 1 μl of one-twentieth (1:20) diluted first PCR reaction mixture as a template DNA as mentioned above.
We isolated 45 endophytic and phytopathogenic fungal candidates from P. thunbergii needles collected in Shimane prefecture, Japan (data not shown). The ITS regions of all of these fungi were sequenced. The frequent endophytic and phytopathogenic fungal candidates were Pestalotiopsis sp., L. conigenum, L. acicola, R. kalkhoffii, and S. pini-thunbergii. Thus, these five species were selected for further investigation (
Sequences of ITS regions of L. conigenum, L. acicola, Pestalotiopsis neglecta, R. kalkhoffii, and S. pini-thun- bergii (
Possible fungal identity | Isolate | GenBank Acc. No. | BLAST match with high similarity | ||
---|---|---|---|---|---|
Definition | GenBank Acc. No. | Similarity (%) | |||
Lophodermium conigenum | A08 | LC033959 | L. conigenum | FJ861972 | 476/478 (99%) |
Lophodermium conigenum | A10 | LC033960 | L. conigenum | FJ861976 | 477/478 (99%) |
Lecanosticta acicola | A03 | LC033961 | L. acicola | HM367708 | 525/525 (100%) |
Lecanosticta acicola | A04 | LC033962 | L. acicola | HM367708 | 525/525 (100%) |
Pestalotiopsis neglecta | A06 | LC033963 | Pestalotiopsis sp. | KF313103 | 566/566 (100%) |
Pestalotiopsis neglecta | J01-2 | LC033964 | Pestalotiopsis sp. | KF313103 | 566/566 (100%) |
Rhizosphaera kalkhoffii | TEC01-1 | LC033965 | Rhizosphaera sp. | HM595558 | 555/558 (99%) |
Rhizosphaera kalkhoffii | TEC01-2 | LC033966 | Rhizosphaera sp. | HM595558 | 555/558 (99%) |
Septorioides pini-thunbergii | TEC01-3 | LC033967 | S. pini-thunbergii | KF251243 | 543/543 (100%) |
Septorioides pini-thunbergii | YA02-1 | LC033968 | S. pini-thunbergii | KF251243 | 543/543 (100%) |
Species | Primer name | Sequence (5’ to 3’) |
---|---|---|
Lophodermium conigenum | Lo1F | TGCCTTGGCGCCTAGCGCCA |
Lo1R | CTCCTACGAGCGGCGAGTAG | |
Lecanosticta acicola | Le1F | GCTCCCGGTGGCCATCTATC |
Le1R | GAACTCCCTAGCGAAAATGT | |
Pestalotiopsis neglecta | Pe1F | CTCGGTGCACCTTACCTTGG |
Pe1R | AAAGACGCTGCAACTCCAGT | |
Rhizosphaera kalkhoffii | Rk1F | TCTCGAGCGCACCGGTTTCT |
Rk1R | CCAGACTTATAAGACGTTTTGATTT | |
Septorioides pini-thunbergii | Sp1F | ACCAGCGCGTCGAGAGGCGC |
Sp1R | AACCTCCAAAGCGAGAAGAAT | |
Pinus thunbergii | rbcLF | CATGGTATCCAAGTTGAAAGAGA |
(RuBisCO large subunit) | rbcLR | CGGTGAATGTGAAGAAGTAG |
of the primer pairs Lo1F/Lo1R, Le1F/Le1R, Pn1F/Pn1R, Rk1F/Rk1R, and Sp1F/Sp1R as a query showed the fungal sequences most similar to L. conigenum, L. acicola, Pestalotiopsis sp., R. kalkhoffii, and S. pini-thunbergii, respectively, suggesting that each primer pair was specific for detecting each phytopathgenic fungus by PCR amplification of the ITS-5.8S-ITS region (data not shown).
To confirm the specificity of the primer pairs, PCR was carried out using each primer pair and the genomic DNA of each phytopathogenic fungus as a template (
that the ITS1/ITS4 primer pair could be used to generally amplify the ITS-5.8S-ITS rDNA of fungi as a universal primer. On the other hand, the use of each specific primer pair was successful for detecting the target species; only the primer pair Rk1F/Rk1R successfully amplified the target DNA in the predicted single band of 393 bp from R. Kalkhoffii (
We evaluated whether any endophytic or phytopathogenic fungi could be detected from a needle (
the withered region of a needle due to DNA degradation. In contrast, amplification products were obtained using ITS1/ITS4 to target the ITS-5.8S-ITS rDNA of fungi in samples A, B and C, indicating whether any fungi were present inside the needle. Furthermore, it was suggested that the fungal biomass of sample B and sample C would be greater than that of sample A because the amplification fragments of sample B and sample C were larger than that of sample A. Nested PCR revealed that S. pini-thunbergii and L. acicola were detected in all samples (A to C), whereas P. neglecta was only detected in sample B (
We tried to evaluate the possibility that these fungi could be detected from needles preserved in a freezer for one week (
Finally, we tried to evaluate the detection of the endophytic and phytopathogenic fungi from healthy needles without any lesions. It was clearly demonstrated that amplification products were obtained using the rbcLF/rbcLR primer pair to target the RuBisCO large subunit gene, whereas no amplification products were visually observed using the ITS1/ITS4 primer pair to target the ITS-5.8S-ITS rDNA of fungi in all samples (
P. neglecta were only detected in sample J, suggesting that L. acicola and P. neglecta were present as endophytic fungi in the healthy needle in sample J (
The identification of endophytic and phytopathogenic fungi relied upon their culture-based morphological characteristics. The detection of these fungi by the traditional methods is time-consuming and requires extensive knowledge of fungal taxonomy. Recently, a variety of molecular tools have been used to differentiate fungal species from one another. Among these tools, species-specific polymerase chain reaction (PCR) has emerged as a powerful method of identifying and detecting fungi (Zhang et al., 2005; Broders & Boland, 2010; Pravi et al., 2014; Popov et al., 2010) . The development of PCR primers specific to the target organism is one of the most important steps in the PCR assay. The ITS regions of rDNA have been widely used to design specific primers for the identification of fungi of interest due to their high copy number and the fact that they contain both conserved and variable regions (Lovic et al., 1995; Ghignone et al., 2003; Stenström & Ihrmark, 2005; Langrell, 2011; Lin et al., 2014) . In addition, a large amount of rDNA sequence data from a variety of fungi is available in public databases. Analyses of these ITS sequences by means of multiple sequence alignment provide valuable information for the designation of species-specific PCR primer pairs. In this report, we demonstrated the detection of endophytic and phytopathogenic fungi from Japanese black pine needles with a PCR procedure using species-specific primers derived from the ITS region of the rDNA of these fungi. All of the primer pairs, Rk1F/ Rk1R, Sp1F/Sp1R, Lo1F/Lo1R, Le1F/Le1R, and Pe1F/Pe1R, were successful in specifically detecting R. kalkhoffii, S. pini-thunbergii, L. conigenum, L. acicola, and P. neglecta, respectively (
Most of the phytopathogenic fungi on Japanese black pines seem to have a weak pathogenicity to the needles of these trees. Infection with Pestalotiopsis spp. was only induced on wounded needles, not on healthy needles (Takahashi & Kobayashi, 1998) , and the pathogenicities of R. kalkhoffiiand S. pini-thunbergii on the needles were rather weak under normal conditions (Tanaka & Chiba, 1971; Kaneko et al., 1989) , although L. acicola and Lophodermium spp. were observed to have pathogenicity on healthy Japanese black pine needles (Suto & Ougi, 1998; Seo et al., 2012; Yamamoto et al., 1964) . On the other hand, these fungi have been reported to be endophytic fungi of conifers, including the Japanese black pine (Yoo & Eom, 2012; Qadri et al., 2014; Ganley et al., 2004; Ganley & Newcombe, 2006) . Thus, these fungi, which are considered to be phytopathogenic fungi, can be considered endophytic fungi of Japanese black pine needles in the initial stage after infection and cause disease with some typical symptoms and reproductive structures such as stromata in the latter stages.
Some endophytic fungi are latent pathogens that cause disease under certain conditions (Begoude et al., 2011; Sakalidis et al., 2011; Stanosz et al., 2001) , while others can enhance host performance by conferring resistance to pathogens (Ganley et al., 2008; Romeralo et al., 2015) . In addition, some endophytic fungi in the needles of conifers have been reported to be decomposers of needle litter (Müller et al., 2001; Korkama-Rajala et al., 2008; Osono & Hirose, 2011; Yuan & Chen, 2014) . In this study, we isolated L. conigenum, L. acicola, P. neglecta, R. kalkhoffii, and S. pini-thunbergii from the Japanese black pine. In the future, these fungi should be characterized in terms of the parasitic or symbiotic relationships between them and their host plants, although the fungi would be considered latent pathogens of the Japanese black pine.
The detection of endophytic and phytopathogenic fungi using the PCR procedure with species-specific primers in this study could not reveal the amount of each endophytic and phytopathogenic fungus that was present. Quantitative real-time PCR assay is a powerful tool for the rapid, specific, and sensitive detection and quantification of fungi (Malvick & Impullitti, 2007) . Furthermore, other latent endophytic and phytopathogenic fungi are likely to exist in the needles of the Japanese black pine. Comprehensive analysis of amplified fragments of the ITS-5.8S-ITS region in Japanese black pine needles could reveal the diversity of endophytic and phytopathogenic fungi that are present. Finally, further methods of diagnosis such as loop-mediated isothermal amplification (LAMP) (Rigano et al., 2014) should be developed to establish a more rapid, more sensitive, and easier procedure for detecting and identifying the endophytic and phytopathogenic fungi in the needles.
This work was supported in part by a research grant from the dean of the Faculty of Life and Environmental Science, Shimane University.