Construction and Analysis of SSH-cDNA Library from Leaves of Susceptible Rubber Clone Resistant to Powdery Mildew Induced by BTH ()
1. Introduction
Rubber tree (Hevea brasiliensis) is a very important tropical industrial crop. Powdery mildew disease caused by Oidium heveae is one of the most important leaf diseases and impacts severely to the growth and latex production of rubber trees [1]. To control this disease, rubber resistance clone breeding and chemical control were employed generally [2]. Recently, induced rubber resistance to powdery mildew by oligosaccharin [3] and BTH (benzothiadiazole-7-carbothioic acid S-methyl ester or acibenzolar-S-methyl) [4] and to anthracnose (Colletotrichum gloeosporioides) by BTH [5] was studied.
BTH, analogs of salicylic acid, is an excellent chemical inducer that can induce plant resistance to pathogens [6], insects [7], nematodes [8] and parasitic weeds [9]. The mechanism of BTH induced resistance is activation of the plant defense genes and expression resistance-related proteins or enzymes [10]. The defense-related genes of BTH induced diseases resistance to rice, wheat [11], cucumber [12], papaya [13], coffee [14], cocoa [15] and so on were identified and analysed. In rubber tree susceptible clone against the diseases, the peroxidase, phenylalanine aminolyase and β-1,3 glucanase are increasing significantly in leaves after BTH treatment [4,5]. No report has been found so far on BTH induced defense genes in rubber tree susceptible clones against the disease. To understand the mechanism of BTH induced rubber tree resistance to powdery mildew in molecular knowledge, a cDNA library of BTH-induced resistance to the disease of rubber tree was constructed through SSH (suppression subtractive hybridization) and the function of differentially expressed genes induced by BTH was analysed.
2. Materials and Methods
2.1. Plant Growth and Pathogen Collection
Rubber budding seedlings (Reyan 7-33-97 clone, susceptible to powdery mildew [16]) were provided by Rubber Research Institute of CATAS. The seedlings were grown in plastic bags with leaves bronze to light green stage and kept in plant growth chamber with temperature at 25˚C, humidity at 80% and 12 h/12 h at light/dark. Fresh conidia of powdery mildew (Oidium heveae) were collected in suspension from infected rubber tree leaves and adjusted to 5 × 104 spores/ml under a microscope.
2.2. BTH Treatment and the Pathogen Inoculation
The healthy leaves of rubber budding seedlings were sprayed uniformly with BTH (Bion 50%WG, Syngenta) at 250 mg a.i. l−1. The spore suspension was sprayed on the leaves after 5 days of BTH spray. The leaves were collected after 4 days of inoculation. Blank control was the some clone and only inoculated with the pathogen. The leaves were stored at −70˚C till for total RNA extraction.
2.3. Total RNA Extraction and mRNA Purification
The BTH treatment and the pathogen inoculation were as the tester and the only pathogen inoculation was as the driver. The total RNAs of tester and driver leaves were extracted with the modified Bugos extract [100 mmol·l−1 Tris, 200 mmol·l−1 Nacl, 15 mmol·l−1 EDTA, 0.5% (W/V) SDS]. The total RNA was dissolved in DEPC-H2O after treatment with DNase I (TaKaRa, Dalian, China) for 30 min at 37˚C. The extracted RNA was kept in cryopreservation for integrity examination with 1.2% agarose gel electrophoresis and amount and purity detection with UV at A260/280. mRNAs of tester and driver from the RNAs were purified with OligotexTM-dT30
mRNA Purification Kit (TaKaRa, Dalian, China) and used for cDNA library construction.
2.4. Differentially Expressed cDNA Library Construction, Adaptor Ligation Detection and Transformation
The differentially expressed cDNA library of BTH induced resistance to the pathogen was constructed with PCR-SelectTM cDNA Subtraction kit (TaKaRa, Dalian, China). The adaptor ligation efficiency before and after SSH was detected by primer of Actin gene [17] (a housekeeping gene of rubber, designed as ACTIN-F: 5’- CAGTGGTCGTACAACTGGTAT-3’ and ACTIN-R: 5’- ATCCTCCAATCCAGACACTGT-3’, synthesized by SBS Genetech, Beijing, China). Adaptor ligation 1 or 2 was used as a template for the tester cDNA. PCR amplification was conducted respectively with the primer Actin 3’ as one side and Actin 5’ or adaptor ligation 1 as another side. The purpose cDNA fragments 3 μl, pMD18-T Vector (TaKaRa, Dalian, China) 1 μl, Ligation Solution I 5 μl and ddH2O 1 μl were mixed in microcentrifuge tube and slightly centrifuged, then transformed into E. coli DH5α. The droplets on the tube wall were put down on the bottom of test tube and overnight at 16˚C. 50 μl of competence was poured into 1.5 ml centrifuge tube with 10 μl ligation product. The tube was placed on ice bath for 20 min, shocked at 42˚C for 90 sec and immediately placed on the ice bath for 2 min again. The tube was shook at 37˚C for 45 min after addition of 700 μl LB medium.
2.5. cDNA Library Reorganization Rate Detection
The conversion products were coated on LB ampicillin plates with X-gal and IPTG and cultured at 37˚C under dark conditions for 12 - 16 h. The positive clones were identified after coloration at 4˚C when the colony size was suitable. Recombination rate of cDNA library was calculated.
2.6. Fragment Length Recognization and Recombinant Sequence
A 25 μl reaction system [10 × Buffer (Mg2+) 2.5 μl, dNTP (2.5 M) 2 μl, rTaq (5 U/μl) (Sangon Biotech, Shanghai, China) 0.25 μl, primer 1 (20 pm) 1.5 μl, primer 2 (20 pm) 1.5 μl, template 0.5 μl, sterile water 16.75 μl] was prepared in 0.2ml PCR tube and immediately accessed to the following cycle after centrifugation: 4.5 min at 94˚C, 35 sec at 94˚C, 30 sec at 66˚C for 30 cycles; then 1.5 min at 72˚C and 5 min at 72˚C. The reactant of 5 μl was loaded on 1.2% agarose gel electrophoresis. The inserted fragments of positive clones identified by PCR were sequenced.
3. Results
3.1. The Total RNA Extraction
2 bright bands of total RNAs were appeared after agarose gel electrophoresis, corresponding to 28S and 18S rRNA with a ratio of intensity at 2:1 (Figure 1). The UV absorbance of the RNAs was at 1.89 - 2.03 (common value at 1.9 - 2.1). This indicated that the extracted total RNAs were high quality, and corresponding to build library.
3.2. The Adaptor Ligation Efficiency
The connection efficiency of the adaptors 1 and 2 was more than 25% (Figure 2). The efficiency met the requirement.
3.3. cDNA Library Subtractive Efficiency
There was appearance of lighter bands after the 18 cycles on the samples before subtraction and after the 28 cycles on the samples after subtraction (Figure 3). The more than 10 cycles meant that the most of expressed constitutive genes were effectively removed. The subtractive library was high quality.
3.4. Differentially Expressed cDNA Examination
A total of 18,350 clones were collected in cDNA library,

Figure 1. Total RNAs integrity from rubber tree leaves; Lane 1: tester, Lane 2: driver, Lane M: Marker DGL2000 (TakaRa).

Figure 2. Efficiency of the adaptor ligation with Actin; Lane 1: tester1-1 as the template and the actin3’ primer, PCR primer1; Lane 2: tester1-1 (adaptor1-ligated-cDNA fragment) as the template and the actin3’, 5’ primer; Lane 3: tester1-2 as the template and the actin 3’ primer, PCR primer1; Lane 4: tester1-2(adaptor 2R ligated-cDNA fragments) as the template and the actin 3’, 5’ primer; Lane M: Marker DGL2000.

Figure 3. Evaluation of subtraction efficiency; Lanes 1-5: Subtracted samples after 18, 23, 28, 33 and 38 cycles of amplification; Lanes 6-10: Unsubtracted samples after 18, 23, 28, 33 and 38 cycles of amplification; Lane M: Marker DL2000.
thereinto, 15,180 clones was white spots. The positive rate was 99% after PCR identification with random 400 white spots. The recombination rate was 82.7%. The cDNA library met the general requirement.
The size of cDNA inserted fragment was different and most in 400 to 1000 bp after PCR amplification with the random differentially expressed cDNA clones. The constructed cDNA library insert size was consistent after electrophoresis (Figure 4).
3.5. The Sequence Analysis and Gene Functional Annotation
There were 23 cDNA sequences and 2 repeats known as function as energy and basic metabolism, signal transduction, membrane and transport, secondary metabolism and so on, 13 sequences unknown of function, 2 sequences no significant match and 2 clones no needed sequences after detection of the sequences of 42 positive clones randomly selected from the cDNA library and comparison on nucleic acid sequences in Genbank (Table 1). 7 ESTs were logged in Genbank and accession numbers were GW873071 and GW874604-GW874610. Parts of the sequences and their functions were attached in Appendix, including disease resistance and defense response gene—zinc finger protein, signal transduction protein— kinase and ion channels—membrane water channel protein.
4. Discussion
During the plant growth process, it would be attacked by many pathogen microorganisms, appearing as disease susceptible or resistant. The process of disease resistant of plant is an outcome by a series of signal recognition, signal transduction, defense reaction activation and the coordinate action of defense gene expression. SSH technology has obvious advantage in gene expression of concentration difference. Therefore, it has been used broadly for understanding the gene differences of plant

Figure 4. Identification of inserted fragments in plasmids of subtractive cDNA library by PCR; lane M: Marker DGL- 2000, Others: inserted fragments in subtractive cDNA library.
Table 1. Sequence alignment and annotation of gene function.

Continued

disease resistance [10] and environment adversity stress [18]. The present study we constricted BTH inducing positive and negative SSH-cDNA library of the rubber blade. There were 13 sequences that their function was unknown. It would possibly imply some important genes related to the disease resistant. There were 2 sequences that had no obvious match. It might be represented novel unknown genes or high variable cDNA noncoding region sequences. All these are valuable to be further study.
In the present study, constructed SSH-cDNA library has coded zinc finger protein gene occurring (ESTs accession numbers: GW874607). Zinc finger protein recognizes transcription factor structure of special alkaline residue sequence. The function of lant C2H2 zinc finger protein is possible related to plant bio-organism or biological stress. The C3H group of RAR1 and HvRar1 zinc finger protein genes from Arabidopsis thaliana has been proved to be located in the relative tight squeezed location of disease resistance [19-21]. In constructed SSHcDNA library, it also has water channel protein gene (ESTs accession numbers: GW874608) appearing. Water channel protein belongs to membrane intrinsic protein. Its expression is influenced by many hormones (ABA, GA) and environment factors (blue light, water stress and pathological infection). Yamada et al. (1995) [22] found that under high salt stress, level of mRNA expressed water channel protein in ice plant declines rapidly. The mRNA level would gradually recover to its original level or much higher level as along with accumulation of osmosis active substances (such as sucrose and polyamine) in the cell. So, it can enhance resistance after expression of inducing water channel protein [23]. In addition, we fund that inorganic phosphate transferring and light harvesting proteins were excited. It is sure after BTH induction, the transferring activity of the host is more active, the function of substances transferring is enhanced, even discover of the presence of inorganic phosphate transfering protein and light harvesting proteins are unable make sure their genes relating to disease resistant directly. In this study, the sequences encoding aspartic protease precursor, calreticulin and cyclophilin were appertaining. These proteins all have disease resistant role in animals and plant, as well as in human [24,25]. We presume these protein genes likely participate in the reaction of rubber resistant to powdery mildew. We also fund some genes (The factors causing stress include cold, salt, drought, and pathogenic bacteria) relating to biological and nonbiological stress. For example, the genes of coded stress response protein are considered to play a role in coordination of resistant outside stress in plant.
In conclusion, BTH induces resistant to rubber powdery mildew disease relating to many ways including recognizing process of pathogen and host, translocating process of signal substances, starting various disease resistance pathways in host and final producing large amount of resistant-related substances against powdery mildew invasion and hypha extension. Our results demonstrated BTH could effectively induce resistant to rubber powdery mildew disease, it provides a new way for controlling such disease, and also provides an useful information for further study on the expression and signal transduction of rubber defense genes.
5. Acknowledgements
We thank Mr. Cheng Bai (EPPI, CATAS) for the correction.
Appendix
Parts of the Sequences and Their Functions
1. Disease Resistance and Defense Response Gene— Zinc Finger Protein TCGAGCGGCCGCCCGGGCAGGTACAAGCAATTGGAATACTTCCAACAATACCAGCAAAGGGTTACTGGGCTTATTGGAGCTGAGCAAACTCAGAGATTAGTTAATGAAGCACTTGTCCTTATGACCGTGGGAGGCAATGACTTTGTTAACAACTACTATTTGGTCCCCTTCTCTGCTAGATCTCGCCAATTCTCCCTCCCAGACTATGTAGTCTACGTCATCTCCGAGTACCTCGGCCGCGACCACGCTA

2. Signal Transduction Protein—Kinase TAGCGTGGTCGCGGCCGAGGTACATAAAGCTTCCCTTCATCACCCATTACTGGATCACAAACATATGTAAGTTTGGGATTTATGAAGCGAAGCTTGTTGACAACTTCCAATACAGTGTCCAAAAATGAAACTGAACCAATATAACCTGTTAACAAATGAGTATAATACAGCAAGTCATTTGCTTCAAGGCCTTCTATTAAATCCCATAGTTGCTGTCCATTCAAAACTTGGCCTTTAAAGGAAGGATATCCTGTGTGATTTGAGACCTGCCCGGGCGGCCGCTCGAA

3. Ion Channels—Membrane Water Channel Protein TAGCGTGGTCGCGGCCGAGGTAAGGAGGTGAGTGAAGAAACGCAGCCTACCCATGGGAAGGACTATGTTGATCCACCACCAGCTCCTCTCATTGACGTGGCTGAGCTCAAGCTCTGGTCTTTCTACCGTGCTCTTATAGCTGAGTTCATAGCCACTCTTCTTTTCCTCTACATCACTGTAGCTACTGTAATTGGCTACAAGAAACAAGCTGACCCTTGTGGCGGAGTTGGGCTTCTGGGTATTGCATGGGCCTTTGGTGGCATGATTTTTATCCTTGTTTACTGCACTGCTGGTATCTCTGGTGGTCATATTAACCCAGCGGTCACTTTTGGACTTTTCTTGGCGAGGAAGGTGTCACTGATTAGGGCAGTGGCTTACATGGTGGCTCAGTGCTTGGGTGCAATCTGTGGTGTTGGGTTGGTGAAGGCATTTATGAAGCATCCATATAATGCTCTTGGAGGCGGTGCTAACTCCGTGGCTCATGGTTACAACAAAGGCACCGCTTTGGGTGCTGAGATCATAGGCACTTTTGTGCTTGTCTACACTGTTTTCTCTGCAACTGACCCTAAGAGGAGTGCACGTGACTCTCACGTCCCTGTGTTGGCTCCTCTTCCAATTGGGTTTGCTGTGTTCATGGTCCACTTGGCAACAATCCCCATCACTGGTACCTGCCCGGGCGGCCGCTCGAA

NOTES
#Works now at Yunnan Academy of Agricultural Sciences.
†Corresponding author.