Evaluation of immunogenicity elicited from two DNA vaccine candidates that expresses the prM and E genes of the dengue-3 virus

doi:10.4236/health.2010.211193

Paper Menu >>

Journal Menu >>

Vol.2, No.11, 1298-1307 (2010)

doi:10.4236/health.2010.211193

Health

Evaluation of immunogenicity elicited from two DNA

vaccine candidates that expresses the prM and E

genes of the dengue-3 virus

Sérgio O. de Paula1*#, Rafael F. O. França2*, Danielle M. Lima2, Nina R. Dutra1,

Marília B. de Paula1, Michelle D. de Oliveira1, Leandro L. de Oliveira1,

Benedito A. L. da Fonseca2

1Department of General Biology, Federal University of Viçosa, Viçosa-MG, Brazil; #Corresponding Author: depaula@ufv.br;

2Department of Internal Medicine, School of Medicine of Ribeirão Preto - USP, Ribeirão Preto, Brazil.

Received 18 August 2010; revised 25 August 2010; accepted 30 August 2010.

ABSTRACT

In this work, we report the evaluation of two

DNA vaccines against dengue-3 virus (DENV-3).

The first construction, called pVAC3DEN3, was

engineered inserting the pre-membrane (prM)

and envelope (E) gene of DENV-3 truncated with

a restriction site between them, as previously

described. The second construction was de-

veloped cloning the full gene sequence of prM

and E from DENV-3 virus in pCI plasmid for

mammalian expression and was denominated

pVAC1WDEN3. The results showed that both

constructions were capable of expressing the

prM and E proteins, as demonstrated by ELISA

and immunoblotting detection in cell culture

transfected with the plasmids. After positive “in

vitro” results, the vaccine candidates were used

to immunize BALB/c mice and the elicited re-

sponse was investigated. After immunization by

intramuscular inoculation with three doses of

each vaccinal clone the animals were sacrificed,

the cytokine levels and T cell response were

analyzed in the spleens, after three days of cul-

ture with stimulus, our analysis showed that the

two constructions elicited T cell responses mea-

sured by BrdU incorporation assay and high

levels of IFN-γ, detected in the supernatant of

the cultures. Moreover, both constructions in-

duced detectable titers of neutralizing antibod-

ies in mice. And finally the survival rate of the

immunized animals after intracerebral challenge

was analyzed, showing a better result in the

pVAC3DEN3 group with an 80% survival com-

pared with a 50% survival of the pVAC1 WDEN3.

Thus, these data showed that our two construc-

tions were able to induce specific immune re-

sponse and protects mice against a lethal chal-

lenge with DENV-3, and these vaccine candi-

dates can be employed to develop a viable den-

gue vaccine.

Keywords: Dengue; DNA Vaccine; E Protein

1. INTRODUCTION

Immunoprophylaxis is well recognized as the most

successful and widely used type of medical intervention.

Some preventive vaccines, used until today, have virtu-

ally eliminated some of the worst human diseases such

as polio and smallpox. However the need for vaccines

against other diseases, such as dengue is urgent [1].

Dengue fever is a mosquito-borne viral disease caused

by infection with the dengue virus, the disease generally

has a febrile and self-limited course [2]. Infection with

any of the four viruses promotes life-long immunity to

the same serotype, but not to other serotypes. Thus, peo-

ple living in an endemic area can acquire four different

infections in their lifetime, each caused by one serotype

[3,4]. Currently, the estimated global number of people

at risk of dengue infections is approximately 2.5 billion,

with almost a half million of these cases progressing to a

potentially fatal syndrome known as dengue hemorrha-

gic fever (DHF) and dengue shock syndrome (DSS) re-

sulting in more than 20,000 deaths per year [5,6].

The expansion of dengue in the tropical areas, ac-

companied by a large increase of cases of DHF lead this

disease to assume a public health importance, unfortu-

nately the only available way to combat the disease is

based on vector control and this measure has proven di-

fficult and costly to sustain over time. Currently there

*Both authors contributed with the same amount of work to the com-

letion of

his stud

S. O. de Paula et al. / HEALTH 2 (2010) 1298-1307

1299

are vaccines against only few human flaviviruses, the

yellow fever virus, tick borne encephalitis virus and the

Japanese encephalitis virus, thus the development of a

vaccine against dengue is urgent and given the difficulty

to achieve this, it represents a great challenge [7-9].

Given that traditional methodologies, such as viral at-

tenuation or even viral inactivation, to develop a dengue

effective vaccine were not successful, several new ap-

proaches have been planned, these include the use of

molecular biology techniques mainly including im-

provement of DNA vaccines [10,11]. DNA vaccines offer

the advantage of being secure, having a low cost produc-

tion and long-term duration of immune responses [12].

Many research groups have reported the induction of im-

mune responses in animal models, elicited by DNA vac-

cines, against a number of viruses including some fla-

viviruses [13-16]. However, it is believed that the effec-

tiveness of DNA vaccines can be distinct from each other,

even if the same antigen is targeted, since the different

DNA construction strategy adopted may affect antigen

presentation to the host immune system and consequently

influence the elicited immune response [17,18].

The four dengue viruses are enveloped and present a

spherical form with approximately a 50nm diameter; the

envelope is acquired trough budding from the endoplas-

mic reticulum. These virions contain three structural pro-

teins: capsid (C), membrane (M) and envelope (E) and a

simple positive RNA strand genome. The membrane

precursor, prM, is believed to help in the folding of the E

glycoprotein and both are integrated in the lipid bilayer

of the mature virion by two transmembrane regions that

surround a nucleocapsid. The surface of the mature DENV

is smooth with the envelope proteins aligned in pairs

parallel to the virion surface. The E glycoprotein medi-

ates cell attachment and fusion and is also the major tar-

get of protective antibodies [19,20]. In fact, the main ex-

perimental vaccines against dengue are directed to elicit

immune responses against the glycoprotein E, which

contains the most epitopes responsible for neutralization

events [21,22].

Recently we demonstrated that the administration of a

DNA vaccine, designated to express the truncated prM

and E gene of the dengue-3 virus, was capable of induc-

ing an immune response with the production of neutral-

izing antibodies and protection against intracerebral cha-

llenge in mice [23]. However, this vaccinal plasmid

show- ed a mutation in the prM region. To evaluate if

this mutation could compromise the immunogenicity of

our con- struct, or even if the restriction site between the

genes could impair the antigen presentation in vivo, in

this work we constructed a new plasmid encoding the

prM and E sequence of DENV-3 without restriction site

between the viral glycoproteins and without mutations

for test. Both constructs, the truncated and the full length

sequence, were designated to express the viral glycopro-

teins prM and E employing the pCI plasmid for mam-

malian expression. Here, we compared these two con-

structions on their ability to induce protection in mice.

Our results demonstrated that these constructions were

capable of drive the expression of the viral glycoproteins

in mammalian cells. In addition, these engineered vac-

cinal clones elicited specific antibodies in mice confer-

ring protection against DENV-3 challenge in these ani-

mals, but surprisingly the new clone, without any muta-

tion in all sequence, was less effective in protect mice

from virus challenge and eliciting a weak immune re-

sponse.

2. METHODS

2.1. Cell Line, Virus, Plasmids and Animals

C6/36, Vero and HeLa cells were purchased from the

Cell Culture Section of Adolfo Lutz Institute, São Paulo,

Brazil. DENV-3, H-87 strain, was kindly donated by Dr.

Robert E. Shope, University of Texas at Galveston, TX.

The expression plasmid (pCI) was purchased from Pro-

mega Corporation, Madison, WI. BALB/c mice, aged

2-3 week, were bred and maintained under standard con-

ditions in the animal house of the Medical School of Ri-

beirão Preto, University of São Paulo, Ribeirão Preto, SP,

Brazil. All animal experiments were performed in accor-

dance with protocols approved by the School of Medi-

cine of Ribeirão Preto Institutional Animal Care and Use

Committee.

2.2. Construction of Plasmids Expressing

PrM/E Proteins

Dengue virus RNA was purified from 0.5 ml of a su-

pernatant of the C6/36 cell culture infected with DENV-

3 using a Trizol Reagent (Invitrogen, Gaithersburg, MD)

according to manufacturer´s recommendations. The

RNA was reverse transcribed in a standard reaction us-

ing a random hexamer primer and Superscript Mix (Invi-

trogen, Gaithersburg, MD). The resultant cDNA was used

to amplify different segments of the virus genome, using

primer pairs shown in Table 1. In order to express the

DENV-3 prM/E proteins, two strategies were used. In a

previous work, due to the difficulty in amplifying the

whole fragment of 2044 pb, we opted to clone the viral

gene by amplifying separately two fragments, the first of

1393 and a second of 651 pb, these fragments were li-

gated to each other by a cloning site with AccI restriction

enzyme to give rise a fragment of 2044 pb containing the

prM and E viral glycoproteins, this vaccinal clone was

denominated PVAC3DEN3 [23]. In thiswork, a whole

fragment of 2044 bp was ampl fied without any restriction i

S. O. de Paula et al. / HEALTH 2 (2010) 1298-1307

1300

Table 1. Construction of recombinant plasmids containing segments of dengue virus 3 genome.

Primers Sequence Fragment Specific Nucleotide Position

sDEN3Mlu

cDEN3Acc

5’GGGACGCGTACATCGTGTCTCATG3’

5’CCCGTCTACATTTTAAGTGCCCCG3’ 1393 bp 364-1757

sDEN3Acc

cDEN3Not

5’GGGGTAGACTCAAGATGGACA3’

5’CCCGCGGCCGCGATTCAGCTTGCACCACGACCC3’ 651 bp 1758-2409

sDEN3Mlu

cDEN3Not

5’GGGACGCGTACATCGTGTCTCATG3’

5’CCCGCGGCCGCGATTCAGCTTGCACCACGACCC3’ 2045 bp 364-2409

site between the viral glycoprotein prM and E. After clo-

ning in the vector TOPO TA, the fragments were cloned

in the pCI expression vector (Promega, Madison, WI)

and the resultants plasmids were subjected to standard

nucleotide sequencing.

2.3. Nucleotide Sequencing of Plasmids

Expressing PrM/E Proteins

Sequencing primers were designed using the DENV-3,

H87 strain (GenBank accession No. M93130) as the geno-

me reference. For whole-region sequencing, PCR primer

pairs were pCIs 5’CACTATAGGCTAGCCTCGAG3’ and

Den3AS1 5’CGCCACTGATCTATCGC3’, Den3S2 5’

GGCGTTAGCTCCCCATGTCG3’ and Den3AS2 5’GC

CATGGTAGTCACACACCC3’, Den3S3 5’CCATGGC

TAAGAACAAGCCC3’ and Den3AS3 5’GTTTCATTT

CCCACCTGGTG3’, Den3S4 5’GAAACGCAGGGAG

TTACGGC3’ and Den3AS4 5’CCTCCTGAGGTTTGG

ATCTC3´, Den3S5 5’GAGATCCAAACCTCAGGAGG

3’ and Den3AS5 5’CCCTTCCTGTACCAGTTGAT3’,

Den3S6 5’ATCAACTGGTACAGGAAGGG3’ and pCIas

5’ATCATGTCTGCTCGAAGCGG3’.

The selected clones were grown at 37℃ in an LB me-

dia with ampicilin and the plasmids were extracted using

the GeneJET Plasmid Miniprep Kit (Fermentas Life

Sciences, US). The plasmids were quantified by UV ab-

sorption (260 nm) and approximately 500 ng of each

plasmid were employed in a reaction with the ABI Prism

Big Dye Terminator Cycle Sequencing Ready kit (Ap-

plied Biosystems). For each sample to be sequenced we

worked with 5 µM of each primer with 2 l of Big Dye,

2 l of Buffer (200 mM Tris-HCl pH 9.0 and 5mM Ma-

gnesium Chloride) and nuclease free water in a final vo-

lume of 10 l. The obtained sequences were aligned

using CLUSTAL W, with a final manual adjustment com-

pleted with BioEdit software and then compared with the

sequences available at the Genbank.

2.4. PrM and E Protein Expression by the

Recombinant Plasmids

PrM and E expression by the recombinant plasmids

was analyzed by transfecting HeLa cells using a cationic

lipid based delivery. Briefly, 30 g of plasmid DNA were

mixed with Lipofectamine 2000 (Invitrogen, Gaithers-

burg, MD) at a lipid mass ratio of 2:1 in 1 ml of Mini-

mum Essential Medium free of fetal bovine serum (FBS)

and incubated for 45 min at room temperature. The

mixture was added to cells grew to about 90% of con-

fluence in 35 mm cell cultures dishes (Costar, Cam-

bridge, MA) and incubated for 72 h at 37℃ in a 5%

CO2 incubator. After incubation, the cultures were proc-

essed for the detection of the prM and E protein expres-

sion by indirect immunofluorescence (Tesh, 1979), im-

munoprecipitation and a sandwich-ELISA of the culture

supernants.

2.5. Immunoprecipitation and

Immuno-Blotting

All extracts and supernatants of the transfected cells

were submitted to an immunoprecipitation using a mouse

immune ascitic fluid specific to DENV-3 (MIAF-DENV-3)

produced in our laboratory and Sepharose Protein A

(Amersham Biosciences, NJ, USA). Briefly, 1 ml of the

cellular extract and 2 ml of the supernatant culture was

added to 0.1 vol of MIAF-DENV-3 and incubated at 4℃

for 8 hours in constant agitation. After incubation, 0.1

vol Sepharose Protein A was added to precipitate the

antigen-antibody complex, and incubated at 4℃ for 16

hours. After incubation, the complexes were recovered

by centrifugation at 12.000 g for 30 seconds at 4℃,

washed 3 times with PBS, suspended in load buffer and

submitted to SDS-PAGE. After SDS-PAGE, the proteins

were transferred to a nitrocellulose membrane; the ni-

trocellulose membrane was blocked for 4 hours with

0.5% BSA, washed 3 times with PBS Tween-20, incu-

bated for 2 hours at room temperature with MIAF-

DENV-3 (1:100), washed again, and incubated for 2 addi-

tional hours with an anti-mouse-IgG alkaline phospha-

tase conjugate (Sigma, Saint Louis, Missouri). The mem-

brane was then washed 3 times with PBS Tween-20, and

stained with the Western Blue Substrate for Alkaline

phosphatase kit (Promega, Madison, WI).

2.6. Densitometry Analysis of Expressed

Proteins

The densitometry analysis in detected expressed pro-

teins was performed using the Image Processing in Ana-

lyses in JAVA-ImageJ 1.41 software (National Institute

S. O. de Paula et al. / HEALTH 2 (2010) 1298-1307

1301

of Health-NIH, 2009).

2.7. Sandwich-ELISA

The prM and E protein expression was detected using

a sandwich ELISA. Briefly, 96-well plates were coated

with a high titer human antibody against dengue (1:200)

and then blocked with 2% BSA. The plates were then

incubated with supernatants of transfected cells that con-

tained the expressed proteins, MIAF-DENV-3, alkaline

phosphatase-conjugated anti-mouse IgG, and p-nitrophenyl

phosphatase. The cut off O.D. value for determining se-

rum positivity was calculated as the mean O.D. of the

negative control sera plus 2 standard deviation (S.D.).

2.8. Immunization of Mice with DENV-3 and

Candidate Vaccines

Groups of ten 3-week-old female Balb/c mice were in-

jected by syringe and needle three times into the quadri-

ceps muscle with 100 g of pVAC1WDEN3, pVAC3

DEN3 and pCI. The mice were primed on day 0 and

boosted on days 10 and 30 with 100 g of DNA in a

25%-PBS sucrose solution. In parallel, another group

with 10 mice were immunized three times into the quad-

riceps muscle with 1 × 105 plaque-forming units per ml

(PFU/ml) of DENV-3. Prior to boosting, blood samples

were obtained through the retroorbital route. Blood sam-

ples were also obtained 10 days after the last inoculation.

Sera from these mice were stored at –70℃ until use.

2.9. ELISA and Plaque Reduction

Neutralization Test (PRNT)

DENV-3 antibody was detected by a solid-phase en-

zyme-linked immunosorbent assay (ELISA) using 96-

well ELISA plates coated with 100 l of DENV-1 and

DENV-2 antigens (8 hemaglutination units) and incu-

bated ON at 4℃. ELISA plates were then blocked, washed

and incubated with murine serum samples at 1:10 dilu-

tion in PBS for 60 min. They were then washed three

times with PBS containing 0.5% Tween-20, and reincu-

bated for another 60 min with horseradish peroxidase-

conjugated goat anti-mouse IgG. Plates were washed three

times and incubated with 0.1 M sodium citrate buffer

(pH 5.0) containing 2.2 mM O-phenylene-diamine and

0.045% H2O2, and read at 490 nm. The cutoff O.D. value

for determining serum positivity was calculated as the

mean O.D. of the negative control sera plus 2 S.D.

The mice serum was also assayed for DENV-3 neu-

tralizing antibody in a plaque reduction neutralization

test (PRNT) as previously described by Russell and

Nisalak [24]. The percentage of plaque reduction was cal-

culated for each dilution of tested sera using the number

of plaques obtained with normal mouse serum as the

baseline and the end-point of this assay was 1:4.096. The

highest dilution of sera yielding a 50% or greater de-

crease in the number of plaques was considered to be the

neutralization antibody titer. The statistical analysis (Tu-

key test with 5% significance) was performed with Graph-

Pad Prism 5.0 (GraphPad Software Inc, San Diego, CA).

2.10. Quantification of Th1 Immune

Response Cytokines (IFN-, IL-2)

and Th2 Immune Response Cytokines

(IL-4, IL-10) Production from

Virus-Stimulated Lymphoid-Cell by

ELISA

Lymphoid cells from spleen of immunized and control

mice (n = 5) were washed twice in RPMI 1640 contain-

ing 10% heat-inactivated FBS. Cells were resuspended

at a final concentration of 1 × 106 cells per ml in RPMI

1640 and 100 l aliquots were plated into 96-well cul-

ture plates. Then, 1 × 105 PFU/ml of heat inactivated

DENV-3 was added to each well to a final volume of

200 l; plates were covered and incubated at 37℃ in a

5% CO2 atmosphere. Following stimulation, aliquots of

supernatants were removed after 48h and stored at –70℃

for subsequent analysis. Sandwich-type ELISA (Du-

oSet, R&D Systems, MN) were used to estimate the

IFN-, IL-2, IL-4 and IL–10 levels in the supernatants of

virus-stimulated cells, according to manufacturer’s in-

structions. Briefly, serial dilutions of cytokine standards,

samples and controls were added into 96-well micro-

plates coated with specific monoclonal antibody and in-

cubated for 2 h at room temperature. Plates were then

washed five times with PBS/T (PBS/0.5% Tween) and

100 l of horseradish-peroxidase-linked polyclonal an-

tibody specific for mouse cytokines were added. After

2h of incubation at room temperature, the plates were

washed five times and 100 l of a substrate solution

were added per well. After 30 min incubation at room

temperature, the plates were read at 450 nm. Levels of

cytokines in the supernatants were calculated based on

the comparison of their OD with the standard calibration

curve. The statistical analysis (Tukey test with 5% sig-

nificance) was performed with GraphPad Prism 5.0

(GraphPad Software Inc, San Diego, CA).

2.11. T Cell Proliferation Assay

The DENV-3 specific lymphoproliferative responses

from DNA-immunized mice were determined by Cell

Proliferation ELISA (BrdU Lymphoproliferation kit Ro-

S. O. de Paula et al. / HEALTH 2 (2010) 1298-1307

1302

Openly accessible at

che, Mannheim, Germany). Spleens were prepared from

recombinant pVAC1WDEN3 pVAC3DEN3, DENV-3,

and pCI-inoculated from 5 mice per group. Cell suspen-

sions were treated with Tris-buffered ammonium chlo-

ride to eliminate the red blood cells, washed, and resus-

pended in RPMI 1640 supplemented with 5% FBS,

HEPES buffer, L-glutamine, penicillin and streptomycin.

Cells were cultured in triplicate in 96-well microtiter

plates (1 × 106 cells/200 l per well) in the presence of

heat inactivated DENV-3 (1 × 104 PFU/ml or 1 × 106

PFU/ml), control RPMI medium, and ConA (0.1 g/ml).

After 72 h, cultures were pulsed with 10 M BrdU and

incubated for 24 h at 37℃. The labeling medium was

then removed by suction and the plate was dried at 60℃

for 1 h. The cells were fixed with FixDenat solution,

incubated with anti-BrdU POD antibody, and the anti-

gen-antibody reaction was detected by the subsequent

substrate reaction read at 450 nm. The statistical analysis,

Two-way Anova followed by Bonferroni post test, was

performed with GraphPad Prism 5.0 (GraphPad Software

Inc, San Diego, CA).

2.12. Challenge Experiments in Mice

Groups of 10 3-week-old female Balb/c mice, were

immunized with 100 g of recombinant pVAC1WDEN3,

pVAC3DEN3 and pCI DNA in sucrose 25%-PBS. Re-

combinant clones were intramuscularly injected into the

quadriceps of the mice and boosted with 100 g DNA 10

and 20 days later. A group with 10 mice was also immu-

nized with 1 × 104 PFU/ml of DENV-3 intraperitonially

and boosted on the same scheduled dates. Twenty-one

days after the third inoculation, mice were challenged

intracerebrally with 50 LD50 (1 × 105 PFU/ml) of DENV-3,

prepared from DENV-3-infected suckling mice brains,

and mouse survival was monitored daily for 21 days.

The statistical analysis (Long-Rank test, Mantel-Cox)

was performed with GraphPad Prism 5.0 (GraphPad Soft-

ware Inc, San Diego, CA).

3. RESULTS

3.1. Nucleotide Sequencing of Plasmids

Expressing PrM/E Proteins

When the pVAC3DEN3 clone amino acid sequence

was compared with the published reference sequence,

we found a single mutation in the region of the prM gene,

replacing F to C in position 39 of the amino acid se-

quence. With the objective of improving our DNA vac-

cine, we chose a clone that didn’t demonstrate any muta-

tion in the prM/E genes. This clone originated from the

whole fragment amplification and was called pVAC1

WDEN3.

3.2. Expression of PrM and E DENV-3

Recombinant Proteins

Two recombinant plasmids, pVAC1WDEN3 e pVAC3

DEN3, were selected to be evaluated. They all contained

an ATG codon and a translation initiation site provided

by the forward primers used in the PCR amplification.

They were all designed to express prM and E proteins.

Cells transfected with all two DNA constructs showed

positive IFA with MIAF-DENV-3, while cells trans-

fected with pCI were negative (data not shown). As

showed on Figure 1, a band with a molecular weight of

53-54 kDa, which correlated with the expected E protein

molecular weight, was detected in cell lysates by im-

munoprecipitation followed by immunoblotting. Densi-

tometry analysis of the immunoblotting showed no sig-

nificance difference between pVAC3DEN3 and pVAC1

WDEN3 in the prM/E protein expression on intracellular

fractions (data not shown). Examination of supernatants

by sandwich-ELISA from transfected cells revealed that

the expressed proteins from all 2 clones were also se-

creted into the supernatant (Figure 1).

3.3. Antibody Response in Immunized Mice

Ten mice per group were inoculated with 100 g of

each of the three DNA constructs, DENV-3 and pCI, as

described in the methods. In all groups neutralizing an-

tibody titers were detected, induced by candidate DNA

vaccines in comparison to the antibody titers observed in

the DENV-3 inoculated mice and no statistical difference

was detected among the groups (Figure 2).

3.4. Cytokine Response in Immunized Mice

ELISA results showed that IFN- and IL-2 were syn-

thesized by the lymphocyte cells of mice immunized

with pVAC3DEN3 and IFN-, IL-2 and IL-10 were syn-

thesized by the lymphocyte cells of immunized mice

with pVAC1WDEN3 as shown in Table 2. Spleen cells

of DENV-3 immunized mice produced all four cytokines

tested, demonstrating the ability of a natural infection in

Figure 1. Analysis of DENV-3 prM/E protein expression on

intracellular fractions by immunoprecipitation followed by Im-

munoblotting. HeLa cells were transfected with 30g of puri-

fied pVAC3DEN3 (Lane 1) or pVAC1WDEN3 (Lane 2),

DENV-3 M.O.I = 1 (Lane 3) and pCI as negative control (Lane

). 4

S. O. de Paula et al. / HEALTH 2 (2010) 1298-1307

1303

Table 2. Quantification of Th1 immune response cytokines (IFN-) and Th2 immune response cytokines (IL-4) of mice re-

cipients of DNA vaccines.

IFN-γ IL-2 IL-4 IL-10

stimuli pg/ml pg/ml pg/ml pg/ml

pVAC1WDEN3 DENV-3 361.54 ± 0.2 11.75 ± 1.2 0.0 93.4 ± 2.1

pCI DENV-3 0.0 0.0 0.0 0.0

DENV-3 DENV-3 75.45 ± 1.6 48.25 ± 0.5 28.13 ± 1.7 16.89 ± 1.4

pVAC3DEN3 DENV-3 77.5 ± 1.5 445.73 ± 3.2 0.0 0.0

pCI DENV-3 0.0 0.0 0.0 0.0

DENV-3 DENV-3 125.42 ± 1.6 123.75 ± 1.35 10.32 ± 1.35 56.89 ± 0.8

Figure 2. Plaque reduction neutralization test.

Openly accessible at

inducing a potent immune response. The high levels of

IFN-γ in the vaccinated groups indicate a Th1 pattern

response.

3.5. DENV-3-Specific T Cell Proliferation in

DNA Vaccinated Mice

We evaluated if the plasmid DNA immunization could

induce DENV-3-specific lymphoproliferative response

in Balb/c mice splenocytes, cultivated and assayed with

BrDu in response to specific antigen stimulation. Splenic

lymphocytes derived from pVAC1WDEN3 and pVAC3

DEN3-inoculated animals demonstrated a dose-dependent

proliferative response to inactivated DENV-3, as shown

in Figure 3. Proliferation responses were always higher

than the negative control, and the response of both vac-

cine candidates to a higher dose of antigen was compa-

rable to that observed in DENV-3 immunized mice.

In addition the response of pVAC3DEN3 immunized

group was higher than pVAC1WDEN3 (p < 0.05) in the

cells stimulated with 106 PFU of dengue virus, suggest-

ing a better immunogenicity of this construct.

3.6. Challenge of Immunized Mice

PVAC1WDEN3 and pVAC3DEN3 vaccine candidates

were evaluated in accordance to their ability to induce

protective immunity against lethal challenge with DENV-

3. Groups of 10, three week-old Balb/c mice, were im-

munized with the DNA vaccines, and positive and nega-

tive control mice were immunized with 1 × 104 PFU/ml

of DENV-3 and with 100 g of pCI, respectively. As

shown in Figure 4, immunization with the pVAC3DEN3

induced a solid protection against the DENV-3 challenge

comparable to that observed in DENV-3 inoculated mice,

where 80% of the challenged mice survived. However,

only 50% survival was observed after immunization wi-

th pVAC1WDEN3 (p = 0.304 compared to pCI). The

negative control group, immunized with pCI, presented

approximately 20% survival, as expected for negative

control group. Only the pVAC3DEN3 immunized group

showed statistical signifance in challenge protection

when compared with pCI.

4. DISCUSSION

In general, the DNA vaccines presents many advan-

tages over other immunization conventional strategies,

these include: easiness of production, stability and trans-

port at room temperature, decreased likelihood of repli-

cation interference and the possibility to vaccinate

against multiple pathogens in a single vaccination [1]. In

an effort to develop a DNA vaccine for dengue virus,

based on the envelope viral glycoproteins prM and E, we

expanded our previous work with the pCI plasmid. In a

previous work we constructed a DNA vaccine candidate

inserting the prM and subsequently the E gene of dengue

virus type 3, separated by a restriction site, so the protein

was expressed with the restriction site between the junc-

tion of prM and E. We showed that this construction

named pVAC3DEN3 was capable of inducing protection

in 80% of the immunized animals, after challenge [23]. In

the present report, we compared the response elicited by

two distinct construction methodologies. Now a second

S. O. de Paula et al. / HEALTH 2 (2010) 1298-1307

1304

Openly accessible at

Figure 3. Proliferation responses to dengue virus in mice re-

ceiving the DNA vaccines. Media, negative control (RPMI

Medium as stimulus); DENV3-104: 1 × 104 PFU/ml of heat

inactivated virus; DENV-3 106: 1 × 106 PFU/ml of heat inacti-

vated virus; ConA: Concanavalin A. *p < 0.001 when com-

pared to pCI control group, *p < 0.05 when compared the

pVAC3DEN3 versus pVAC1WDEN3 immunized group (Two-

way ANOVA, Bonferroni post test).

Figure 4. Survival of DNA-immunized mice after challenge

with a lethal dose of DENV-3. There was no statistic difference

between pVAC3DEN3 and pVAC1WDEN3 challenged groups

p = 0.182 and on pCI versus pVAC1WDEN3 p = 0.304, on pCI

versus pVAC3DEN3 (*p = 0.0162) the protection was signifi-

cant (Log-rank Test, Mantel-Cox).

plasmid denominated pVAC1WDEN3 was engineered,

containing again the prM/E genes, however the full se-

quence of the genes were inserted in the plasmid without

any cloning site between them and their immunogenicity

was evaluated and compared.

Expression of the recombinant protein in DNA trans-

fected mammalian cells was analyzed after three days of

transfection. As revealed by immunobloting and ELISA,

the two constructions were able to express the protein,

either secreted on the supernatant culture or cell associ-

ated. Apparently the constructions were functional when

analyzed in vitro, directioning the protein expression that

can be recognized by specific antibodies. The fact that

there were no difference in expression between the con-

structs, when analized by densitometry of the bands in

immunobloting, suggests that the mutation in the prM

region of the pVAC3DEN3 clone did not impaired the

protein expression.

Our data of protein expression by transfected cells is

in agreement with previous works that demonstrate the

prM gene is necessary for the correct expression of the E

protein genes [9,25-27]. The prM protein consists of

approximately 165 amino acids and is accepted that it

might function as a chaperone for folding and assembly

of the E protein [28]. In a work published by Jimenez

and Fonseca [29], in the groups of mice inoculated in-

tramuscularly with a recombinant plasmid expressing

only the E protein of dengue virus 2, containing 94% of

the E gene, no response with anti-dengue antibodies,

cellular proliferation, or synthesis of cytokines by their

lymphoid cells were observed. However, protection was

observed in 20% of the challenged mice immunized with

this recombinant plasmid and the mice survived longer

than the control group. The authors speculate that the

low percentage of protection might be explained by a

weak activation of the immune system resulting from an

imperfect secretion of E protein due to the lack of the

prM protein. Our concern about the mutation in the prM

region of pVAC3DEN3, was if this mutation could im-

pair the expression level of the E protein, resulting in

week immune stimulation, to address if this could be

possible we constructed a new plasmid encoding these

viral genes and selected a construct without mutations.

In our results, the levels of T cell proliferation after

stimulus and even cytokines secretion were similar be-

tween the two constructions, either pVAC3DEN3 or

pVAC1WDEN3. Although, the construction pVAC3 DE-

N3 showed a mutation in the prM region, position 39

replacing F to C in the amino acid sequence, this con-

struct showed a better lymphoproliferative response in

response to dengue stimulus when compared to pVAC1

WDEN3. Briefly, we showed the efficacy of both our

plasmid constructions in express the viral glycoproteins,

assessed in vitro.

There is a consensus that the induction of neutralizing

antibodies directed against the virus envelope (E) protein

is the most important mediator of protection against

dengue infection, thus the induction of protective levels

of neutralizing antibodies is the key of successful immu-

nization [1]. Here, we tested the protection efficacy of

the candidate vaccines by detecting the levels of neu-

tralizing antibodies, the animals vaccinated with pVAC3

DEN3 and pVAC1WDEN3 showed an end point neu-

tralizing titer of 256. The titers of the vaccinated animals

were near to the titers observed in the animals that were

inoculated with the DENV-3, these neutralizing antibod-

ies indicated the induction of humoral immune responses

in the experimental immunization. In a study with re-

combinant MVA (modified vaccinia, Ankara) expressing

only a dengue-2 truncated E protein, PRNT50 titers of 70

and higher as being protective was reported [30]. How-

S. O. de Paula et al. / HEALTH 2 (2010) 1298-1307

1305

Openly accessible at

ever, other authors reported that low antibody titers be-

tween 20 and 80 were also found protective against den-

gue challenge [31]. Wherefore, we believe that our neu-

tralizing antibodies titer, in mice, is sufficient to induce a

good protection against infection.

We analyzed T cell responses by the BrdU incorpora-

tion assay using heat inactivated dengue-3 virus as sti-

mulus. In this work, we showed that all the recombinant

plasmids were immunogenic and elicit T cell prolifera-

tion after 3 days of stimulation in vitro. Although most

of the studies in dengue vaccine development are fo-

cused in analyzing only the generation of neutralizing

antibodies, some authors are interested in study T cell

responses. Khanam et al. 2006 [32] showed that spleno-

cytes, obtained from immunized mice in response to

antigen stimulation in vitro, manifested a significant pro-

liferative response accompanied by the production of

high levels of IFN-, after immunization with a vaccine

candidate to dengue virus type 2 envelope domain III

encoded by plasmid and adenoviral vectors in a prime/

boost strategy. Probably the major focus in antibodies

reflects the scantiness in data about T cells responses in

dengue infections. In our vaccinal strategy, the response

to stimulus in both vaccine candidates (pVAC1WDEN3

and pVAC3DEN3) cultivated spleen cells, produced a

high quantity of IFN- in comparison of IL-4 production.

IL-4 is a B-cell stimulatory cytokine and contributes

markedly to the generation of a dengue virus-neutraliz-

ing antibody response [32]. However the critical question

that we addressed and showed is that our neutralizing

antibody titers were protective in both vaccines, even

without IL-4 detection. These results are in agreement

with another study where the levels of IFN- were higher

than IL-4, obtained from splenocytes in proliferative

response after immunization with a plasmid enconding

the domain III of the dengue 2 E protein [32].

Dengue virus is not usually pathogenic to mice. Al-

though some studies have demonstrated that commonly

used laboratory mouse strains are permissive to dengue

virus infection and even replication, no overt signs of

disease are observed in these animals and wild type vi-

ruses replicate to such low titers in mouse tissues that

they are scarcely detectable [33]. Therefore, the lack of

an appropriated animal model to test vaccine candidates

is one of the major obstacles in the field of dengue re-

search and vaccine development. The mouse model pre-

dominately used to test the efficacy of DENV vaccines is

based in intracerebral infection of mice with mouse-

brain-adapted DENV [34-37]. Employing the model of

intracerebral challenge our animals vaccinated with

pVAC3DEN3 obtained a high survival rate after chal-

lenge (80%). The control group inoculated with the DE-

NV-3 also showed an 80% protection, while the group

inoculated with the pCI plasmid obtained a 20% protec-

tion, the group that received immunization with

pVAC1WDEN3 showed a survival of 50%. This differ-

ence between the vaccinated groups was not surprising,

once that the model of intracerebral challenge does not

represent a natural infection some variation can be ex-

pected. It’s largely discussed by several authors the lack

of a good animal model to test dengue vaccines and

some groups have focused it is efforts to achieve a better

laboratory model [38]. Here we believe that our vaccine

evaluation could be impaired by the mouse model em-

ployed explaining the low level of protection in the

pVAC1WDEN3 immunized group.

In an attempt to improve our vaccine, we constructed

another plasmid expressing the same genes, evaluating

and comparing the immunogenicity of both construc-

tions. In Brazil, the dengue virus represents a health

public problem of great importance since that each sum-

mer dengue outbreak occurs in several urban centers.

Thus, considering that the immune response induced by

pVAC3DEN3, in comparison with pVAC1WDEN3 vac-

cine candidate, and considering the work being carried

out with the other dengue viruses by our group, this vac-

cine candidate will certainly be analyzed in a tetravalent

DNA vaccine format to determine the vaccine efficacy.

5. ACKNOWLEDGEMENTS

This work was supported by Fundação de Amparo a Pesquisa do

Estado de São Paulo (FAPESP), São Paulo, Brazil. SOP was supported

by a FAPESP scholarship.

REFERENCES

[1] Whitehead, S.S., Blaney, J.E., Durbin, A.P. and Murphy,

B.R. (2007) Prospects for a dengue virus vaccine. Nature

Reviews Microbiology, 5, 518-528.

[2] Halstead, S.B. (1989) Antibody, macrophages, dengue

virus-infection, shock, and hemorrhage: A pathogenetic

cascade. Reviews of Infectious Diseases, 11, S830-S839.

[3] Innis, B.L. (1995) Dengue and dengue hemorrhagic fever.

In: Porterfield, J.S. Ed., Exotic Viral Infections, Chapman

Hall, London, 103-146.

[4] Kuno, G. (2004) Serodiagnosis of flaviviral infections

and vaccinations in humans. Advances in Virus Research,

61, 63-65.

[5] Gubler, D.J. (1998) Population growth, urbanization, au-

tomobiles and aeroplanes: The dengue connection. In:

Greenwood, B. and De Cock, K. Eds., New & Resurgent

Infection. Prediction, Detection & Management of To-

morrows Epidemics, John Wiley & Sons, New York, 117-

129.

[6] Gubler, D.J. (2002) The global emergence/resurgence of

arboviral diseases as public health problems. Archives of

Medical Research, 33, 330-342.

S. O. de Paula et al. / HEALTH 2 (2010) 1298-1307

1306

[7] Barrett, A.D.T. (1997) Yellow fever vaccines. Biologicals,

25, 17-25.

[8] Barrett, A.D.T. (1997) Japanese encephalitis and dengue

vaccines. Biologicals, 25, 27-34.

[9] Raviprakash, K., Kochel, T.J., Ewing, D., Simmons, M.,

Phillips, I., et al. (2000) Immunogenicity of dengue virus

type 1 DNA vaccines expressing truncated and full

length envelope protein. Vaccine, 18, 2426-2434.

[10] Edelman, R. (2005) Dengue and dengue vaccines. Jour-

nal of Infectious Diseases, 191, 650-653.

[11] Kinney, R.M. and Huang, C.Y.H. (2001) Development of

new vaccines against dengue fever and Japanese en-

cephalitis. Intervirology, 44, 176-197.

[12] Imoto, J., Konishi, E. (2007) Dengue tetravalent DNA

vaccine increases its immunogenicity in mice when

mixed with a dengue type 2 subunit vaccine or an inacti-

vated Japanese encephalitis vaccine. Vac cin e, 25, 1076-

1084.

[13] Colombage, G., Hall, R., Pavy, M. and Lobigs, M. (1998)

DNA-based and alphavirus-vectored immunisation with

prM and E proteins elicits long-lived and protective im-

munity against the flavivirus, Murray Valley encephalitis

virus. Virology, 250, 151-163.

[14] Konishi, E., Yamaoka, M., Khin Sane, W., Kurane, I. and

Mason, P.W. (1998) Induction of protective immunity

against Japanese encephalitis in mice by immunization

with a plasmid encoding Japanese encephalitis virus

premembrane and envelope genes. Journal of Virology,

72, 4925-4930.

[15] Phillpotts, R.J., Venugopal, K. and Brooks, T. (1996)

Immunisation with DNA polynucleotides protects mice

against lethal challenge with St Louis encephalitis virus.

Archives of Virology, 141, 743-749.

[16] Schmaljohn, C., Vanderzanden, L., Bray, M., Custer, D.,

Meyer, B., et al. (1997) Naked DNA vaccines expressing

the prM and E genes of Russian spring summer encepha-

litis virus and Central European encephalitis virus protect

mice from homologous and heterologous challenge. Jour-

nal of Virology, 71, 9563-9569.

[17] Alves, A.M.B., Lasaro, M.O., Almeida, D.F. and Ferreira,

L.C.S. (1999) New vaccine strategies against enterotoxi-

genic Escherichia coli. I: DNA vaccines against the

CFA/I fimbrial adhesin. Brazilian Journal of Medical

and Biological Research, 32, 223-229.

[18] Donnelly, J.J., Wahren, B. and Liu, M.A. (2005) DNA

vaccines: Progress and challenges. Journal of Immunol-

ogy, 175, 633-639.

[19] Mukhopadhyay, S., Kuhn, R.J., Rossmann, M.G. (2005)

A structural perspective of the Flavivirus life cycle. Na-

ture Reviews Microbiology, 3, 13-22.

[20] Kuhn, R.J., Zhang, W., Rossmann, M.G., Pletnev, S.V.,

Corver, J., et al. (2002) Structure of dengue virus: Impli-

cations for flavivirus organization, maturation, and fusion.

Cell, 108, 717-725.

[21] Brinton, M.A., Kurane, I., Mathew, A., Zeng, L.L., Shi,

P.Y., et al. (1998) Immune mediated and inherited de-

fences against flaviviruses. Clinical and Diagnostic Vi-

rology, 10, 129-139.

[22] Chambers, T.J., Hahn, C.S., Galler, R. and Rice, C.M.

(1990) Flavivirus genome organization, expression, and

replication. Annual Review of Microbiology, 44, 649-688.

[23] De Paula, S.O., Lima, D.M., Oliveira França, R.F., Go-

mes-Ruiz, A.C. and Fonseca, B.A.L (2008) A DNA vac-

cine candidate expressing dengue-3 virus prM and E pro-

teins elicits neutralizing antibodies and protects mice

against lethal challenge. Archives of Virology. 153(12),

2215-2223.

[24] Russell, P.K. and Nisalak, A. (1967) Dengue virus identi-

fication by plaque reduction neutralization test. Journal

of Immunology, 99, 291.

[25] Konishi, E., Pincus, S., Paoletti, E., Shope, R.E., Burrage,

T., et al. (1992) Mice immunized with a subviral particle

containing the Japanese Encephalitis-virus prM/M and

E-proteins are protected from lethal JEV infection. Vi-

rology, 188, 714-720.

[26] Fonseca, B.A.L., Pincus, S., Shope, R.E., Paoletti, E. and

Mason, P.W. (1994) Recombinant Vaccinia viruses co-

expressing Dengue-1 glycoproteins prM and E-induce

neutralizing antibodies in mice. Vaccine, 12, 279-285.

[27] Allison, S.L., Stadler, K., Mandl, C.W., Kunz, C., Heinz,

F.X. (1995) Synthesis and secretion of recombinant Tick-

Borne Encephalitis-Virus protein-E in soluble and par-

ticulate form. Journal of Virology, 69, 5816-5820.

[28] Lorenz, I.C., Allison, S.L., Heinz, F.X., Helenius, A.

(2002) Folding and dimerization of tick-borne encephali-

tis virus envelope proteins prM and E in the endoplasmic

reticulum. Journal of Virology, 76, 5480-5491.

[29] Jimenez, R.O. and da Fonseca, B.A.L. (2000) Recombi-

nant plasmid expressing a truncated dengue-2 virus E

protein without co-expression of prM protein induces

partial protection in mice. Vac ci ne , 19, 648-654.

[30] Men, R., Wyatt, L., Tokimatsu, I., Arakaki, S., Shameem,

G., et al. (2000) Immunization of rhesus monkeys with a

recombinant of modified vaccinia virus Ankara express-

ing a truncated envelope glycoprotein of dengue type 2

virus induced resistance to dengue type 2 virus challenge.

Vaccine, 18, 3113-3122.

[31] Guirakhoo, F., Pugachev, K., Zhang, Z., Myers, G. and

Levenbook, I., et al. (2004) Safety and efficacy of chi-

meric yellow fever-dengue virus tetravalent vaccine for-

mulations in nonhuman primates. Journal of Virology, 78,

4761-4775.

[32] Khanam, S., Khanna, N. and Swarninathan, S. (2006)

Induction of neutralizing antibodies and T cell responses

by dengue virus type 2 envelope domain III encoded by

plasmid and adenoviral vectors. Vaccine, 24, 6513-6525.

[33] Bente, D.A. and Rico-Hesse, R. (2006) Models of den-

gue virus infection. Drug Discovery Today: Disease Mo-

dels, 3(1), 97-103.

[34] Kaufman, B.M., Summers, P.L., Dubois, D.R. and Eckels,

K.H. (1987) Monoclonal-antibodies against Dengue-2

virus E-glycoprotein protect mice against lethal dengue

infection. American Journal of Tropical Medicine and

Hygiene, 36, 427-434.

[35] Bray, M., Zhao, B.T., Markoff, L., Eckels, K.H., Cha-

nock, R.M., et al. (1989) Mice immunized with recom-

binant vaccinia virus expressing Dengue-4 virus struc-

tural proteins with or without nonstructural protein-NS1

are protected against fatal Dengue virus encephalitis.

Journal of Virology, 63, 2853-2856.

[36] Falgout, B., Bray, M., Schlesinger, J.J. and Lai, C.J.

(1990) Immunization of mice with recombinant Vaccinia

virus expressing authentic Dengue virus nonstructural

protein NS1 protects against lethal Dengue virus en-

S. O. de Paula et al. / HEALTH 2 (2010) 1298-1307

1307

cephalitis. Journal of Virology, 64, 4356-4363.

[37] Van Der Most, R.G. and Strauss, J.H. (2000) Chimeric

yellow fever/dengue virus as a candidate dengue vaccine:

Quantitation of the dengue virus-specific CD8 T-cell re-

sponse. Journal of Virology, 74, 8094-8101.

[38] Yauch, L.E. and Shresta, S. (2008) Mouse models of den-

gue virus infection and disease. Antiviral Research, 80,

87-93.